báo cáo khoa học: " A membrane-bound matrix-metalloproteinase from Nicotiana tabacum cv BY-2 is induced by bacterial pathogens" pdf

Báo cáo khoa học: A novel trehalase from Mycobacterium smegmatis ) purification, properties, requirements potx

Báo cáo khoa học: A novel trehalase from Mycobacterium smegmatis ) purification, properties, requirements potx

... the purified fraction from the column. Partial characterization of the trehalase from M. tuberculosis The M. tuberculosis trehalase was isolated from cytoso- lic extracts and partially purified by ammonium ... larger aggregate. The results shown here suggest that the trehalase is also activated and aggregated by phosphate in a similar manner. Interestingly, the trehalase partially...

Ngày tải lên: 16/03/2014, 11:20

14 271 0
Báo cáo khoa học: A peptide derived from cyclin-dependent kinase activator (p35) specifically inhibits Cdk5 activity and phosphorylation of tau protein in transfected cells pdf

Báo cáo khoa học: A peptide derived from cyclin-dependent kinase activator (p35) specifically inhibits Cdk5 activity and phosphorylation of tau protein in transfected cells pdf

... cells Ya-li Zheng, Bing-Sheng Li, Niranjana D. Amin, Wayne Albers and Harish C. Pant Laboratory of Neurochemistry, National Institute of Neurological Disorders and Stroke, National Institutes of Health, ... antibody (Novagen, San Diego, CA, USA). A pcDNA/Amp euk- aryotic expression vector and LipofectAMINE Reagent were purchased from Invitrogen (Carlsbad, CA). pGEM-T vector was obtained...

Ngày tải lên: 23/03/2014, 21:21

8 329 0
Báo cáo khoa học: A new sulfurtransferase from the hyperthermophilic bacterium Aquifex aeolicus Being single is not so simple when temperature gets high potx

Báo cáo khoa học: A new sulfurtransferase from the hyperthermophilic bacterium Aquifex aeolicus Being single is not so simple when temperature gets high potx

... the catalytic domain of thiosulfate cyanide sulfurtransferase (TST) which is distributed among bac- teria, archaea and eukaryotes. Aq-477 catalyses sulfur transfer from thiosulfate, tetrathionate ... protein from the cyto- plasm of A. aeolicus. aq477 is flanked by genes panD and aq478. Because a single base pair separates the termination and initiation codons for panD and aq477, t...

Ngày tải lên: 30/03/2014, 03:20

16 442 0
báo cáo khoa học: " A membrane-bound matrix-metalloproteinase from Nicotiana tabacum cv. BY-2 is induced by bacterial pathogens" pdf

báo cáo khoa học: " A membrane-bound matrix-metalloproteinase from Nicotiana tabacum cv. BY-2 is induced by bacterial pathogens" pdf

... article A membrane-bound matrix-metalloproteinase from Nicotiana tabacum cv. BY- 2 is induced by bacterial pathogens Andreas Schiermeyer* 1 , Hanna Hartenstein 2 , Manoj K Mandal 2 , Burkhard Otte 2 , ... cDNA was amplified with the primer pair NtMMP1-Cterm+GPF_for (5'-CGG CAT GGA CGA GCT GTA CAA GTC TAA CCC AAA TTT TAC TGG G-3') and NtMMP-Cterm_rev (5'...

Ngày tải lên: 12/08/2014, 03:20

12 278 0
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

... at each phase of the cell cycle were estimated from their DNA content histograms after drug treatment. Apoptosis was quantified and distinguished from necrosis by using the Annexin-V-Fluos staining ... which is generally associated with G 2 arrest and the absence of programmed apoptotic death [5]. Be that as it may, daunorubicin and WP631 kill treated Jurkat T lymphocytes by distinct...

Ngày tải lên: 20/02/2014, 23:20

7 582 0
Tài liệu Báo cáo khoa học: "A Tool for Multi-Word Expression Extraction in Modern Greek Using Syntactic Parsing" pdf

Tài liệu Báo cáo khoa học: "A Tool for Multi-Word Expression Extraction in Modern Greek Using Syntactic Parsing" pdf

... subset undergo a statistical analysis process whose aim is to detect those candidates that are highly cohe- sive. A strong association between the items of a candidate indicates that this is likely ... Syntactic Parsing Athina Michou University of Geneva Geneva, Switzerland Athina.Michou@unige.ch Violeta Seretan University of Geneva Geneva, Switzerland Violeta.Seretan@unige.ch Abstr...

Ngày tải lên: 22/02/2014, 02:20

4 491 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

... CCCCATGTCGCCTTTAGT OMCB-KO-R TCGCTAGAACACATTGAC OMCA-F ATGATGAAACGGTTCAAT OMCA-R TTAGTTACCGTGTGCTTC OMCB-F CTGCTGCTCGCAGCAAGT OMCB-R GTGTGATCTGCAACTGTT OMCA-PBAD-F CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC OMCA-PBAD-R ... CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC OMCA-PBAD-R TTAGTTACCGTGTGCTTC OMCB-PBAD-F CACCGAGGAATAATAAATGATG AACGCACAAAAATCA OMCB-PBAD-R TTACATTTTCACTTTAGT Shewanella oneidensis MR...

Ngày tải lên: 07/03/2014, 09:20

11 732 0
Báo cáo khoa học: Chloroplast phosphoglycerate kinase from Euglena gracilis Endosymbiotic gene replacement going against the tide pdf

Báo cáo khoa học: Chloroplast phosphoglycerate kinase from Euglena gracilis Endosymbiotic gene replacement going against the tide pdf

... transfer among prokaryotes [38,39] or to saturation at variable amino acid sites [40]. A strong split recovers the archaebacteria as a monophyletic group that is well separated from the eubacteria. ... be a r elative of extant Kinetoplastida as host cell and a green alga as endosymbiont. Euglena gracilis is linked to t he Kinetoplastida by a number of morphological homologie...

Ngày tải lên: 16/03/2014, 18:20

9 358 0
Báo cáo khoa học: A spectroscopic study of the interaction of isoflavones with human serum albumin pdf

Báo cáo khoa học: A spectroscopic study of the interaction of isoflavones with human serum albumin pdf

... (A- 7638) warfarin (A- 2250), diazepam, triiodobenzoic acid N-acetyltrypto- phanamide, Trizma base, Palmitic acid and N-bromosuccin- imide were from Sigma Aldrich (St. Louis, MO, USA). ANS was from Aldrich ... obtained from the interaction of genistein and warfarin to HSA by CD measurements indicate that both ligands bind simulta- neously to subdomain IIA of HSA. Stoichiometric analy...

Ngày tải lên: 23/03/2014, 11:20

17 457 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC VK2.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC VK3.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC VK4.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCC VL 3a. link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC VL4.link GGCGGATCAGGAGGCGGAGGTTCTGGTG...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
w