báo cáo khoa học: " Control of mandibular incisors with the combined Herbst and completely customized lingual appliance - a pilot study" ppsx

báo cáo khoa học: " Control of mandibular incisors with the combined Herbst and completely customized lingual appliance - a pilot study" ppsx

báo cáo khoa học: " Control of mandibular incisors with the combined Herbst and completely customized lingual appliance - a pilot study" ppsx

... undertaking of the study, interpreted the data and reviewed all iterations of the paper. DW and AH designed the study. AH and RS analyzed the data. DW and RS supervised the clinical sample and data collection. ... Wiechmann et al.: Control of mandibular incisors with the combined Herbst and completely customized lingual appliance - a...

Ngày tải lên: 11/08/2014, 20:20

4 416 0
Báo cáo khoa học: Interactions of imidazoline ligands with the active site of purified monoamine oxidase A potx

Báo cáo khoa học: Interactions of imidazoline ligands with the active site of purified monoamine oxidase A potx

... Garcı ´ a- Sevilla JA (1993) Discrimination and pharma- cological characterization of I-2-imidazoline sites with [ 3 H]-idazoxan and alpha-2 adrenoceptors with [ 3 H ]- Rx821002 (2-methoxy idazoxan) in the ... Pizzinat N, Ordener C, Marchal-Victorion S, Maurel A, Hofmann R, Renard P, Delagrange P, Pigini M, Parini A et al. (2006) 3-5 -( 4,5-dihydro-1H-imidazol- 2-yl)-fur...

Ngày tải lên: 07/03/2014, 10:20

9 473 0
Báo cáo khoa học: Interaction of caspase-3 with the cyclic GMP binding cyclic GMP specific phosphodiesterase (PDE5a1) potx

Báo cáo khoa học: Interaction of caspase-3 with the cyclic GMP binding cyclic GMP specific phosphodiesterase (PDE5a1) potx

... Homology model of PDE 5A1 based on PDE4B2 crystal structure showing how the removal of the C-terminal tail containing Q807 and F810 by caspase-3 a ects the architecture of the cata- lytic site, and in particular ... activity purified caspase-3 in the presence of PDEc [8]. PDE 5A1 cleavage by caspase-3 and/ or caspase-3 activated proteases in Cos-7 cell and PC12 cells...

Ngày tải lên: 17/03/2014, 09:20

9 391 0
Báo cáo khoa học: "Results of species hybridization with Quercus robur L and Quercus petraea (Matt) Liebl" docx

Báo cáo khoa học: "Results of species hybridization with Quercus robur L and Quercus petraea (Matt) Liebl" docx

... the intra- and in- terspecific pollination rates? - What are the growth rate and survival percentage and how do the hybrids look? MATERIALS AND METHODS The Q petraea and ... Kleinschmit and Svolba, 1979; Aas, 1988). In 1989 and 1990, a controlled crossing program of Q robur and Q petraea was ini- tiated on the seed orchards o...

Ngày tải lên: 08/08/2014, 19:21

7 245 0
Báo cáo khoa học: "Incidence of seed migration to the chest, abdomen, and pelvis after transperineal interstitial prostate brachytherapy with loose 125I seeds" pps

Báo cáo khoa học: "Incidence of seed migration to the chest, abdomen, and pelvis after transperineal interstitial prostate brachytherapy with loose 125I seeds" pps

... prostate gland, with a margin of 3 mm anteriorly and laterally and 5 mm in the cranial and caudal directions. No margin was added posteriorly at the rectal interface. Treatment planning used a ... Tokyo 16 0-8 582, Japan Phone: +8 1-3 -5 36 3-3 835 FAX: +8 1-3 -3 35 9-7 425 E-mail: Akitomo Sugawara: h4411@wave.plala.or.jp Jun Nakashima: njun@tokyo-med.ac.jp...

Ngày tải lên: 09/08/2014, 09:21

37 266 0
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

... thrombin anion-binding exosite-1 is a primary part of the allosteric activation mechanism. For many years, the physiological activator of HC-II has been assumed to be extravascular dermatan sulfate [56–64], ... heparin ⁄ heparan sulfate and dermatan sulfate GAGs are physiological activa- tors of HC-II, many different polyanions, including polyphosphates, polysulfates and polyc...

Ngày tải lên: 20/02/2014, 02:21

10 669 0
Báo cáo khoa học: Control of mammalian gene expression by amino acids, especially glutamine potx

Báo cáo khoa học: Control of mammalian gene expression by amino acids, especially glutamine potx

... CHOP ATF2, ATF4 5¢-Flanking region (-3 10 /-3 02) AARE 5¢-ATTGCATCA-3¢ [12,21] NIH/T3T Cystine xCT ATF4 5¢-Flanking region (-9 4 /-8 6 and -7 6 /-6 8) AARE 5¢-TGATGCAAA-3¢ and 5¢-TTTGCATCA-3¢ [30] HepG2 ... Beneficial effects of l-argi- nine nitric oxide-producing pathway in rats treated with alloxan. J Physiol 584, 921–933. 80 Garcia-Macedo R, Sanchez-Munoz F, Almanda-Per...

Ngày tải lên: 07/03/2014, 00:20

19 361 0
Báo cáo khoa học: Control of transforming growth factor b signal transduction by small GTPases pot

Báo cáo khoa học: Control of transforming growth factor b signal transduction by small GTPases pot

... mediates the nuclear entry of the Drosophila R-Smad Mad, and its human orthologues, importin-7 and importin-8, mediate the nuclear translocation of Smad1, Smad2, Smad3 and Smad4 in human cancer ... developmental aspects. RalA ⁄ Ral-binding protein 1 RalA is a multifunctional GTPase that is activated by receptor-activated Ras via recruitment of Ral GEFs [68–70]. Activated R...

Ngày tải lên: 07/03/2014, 01:20

19 266 0
Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx

Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx

... the experiments: Primers Mouse bmajor-globin: US 5¢-AAGCCTGATTCCGTAG AGCCACAC-3¢ and DS 5¢-CCCACAGGCAAGAGACA GCAGC-3¢; mouse ec-globin: US 5¢-CAAAGAGAGTTT TTGTTGAAGGAGGAG-3¢ and DS 5¢-AAAGTTCACCA TGATGGCAAGTCTGG-3¢; mouse ... 5¢GGTACCTATATAGGT GACTTACATA-3¢ and DS: 5¢CACCTAAGACACTGTG GAAGAGCAG-3¢; mouseHS2 US: 5¢GGGTCTCTCTA GGAGGAAGTCCACAGG-3¢ and DS: 5¢CAGATCTAAT GACCCTAACTCTAAC-3¢...

Ngày tải lên: 07/03/2014, 12:20

10 422 0
Báo cáo khoa học: Control of transferrin expression by b-amyloid through the CP2 transcription factor pdf

Báo cáo khoa học: Control of transferrin expression by b-amyloid through the CP2 transcription factor pdf

... : TCCTCGGACTCGAGTCGCCCCGTCCTTCTCCCTCGTCGAGGAGGCACCCCCTGGAAACTCTCGGGTCCTCGTCCT AAAGCTCCCTGTGGACCACCCCTC GTTTTCCACGACTCAGACAGAAACTGGAACTCGGGTCGAACAAAGAGGACG TAGGAGGGGGTTTTCCC CGAAACGGACAGTAAGACGTCAAGATCACACCCCAGACCCGCGTCAAGAAAAGGGAGA GGTCGGAGCCTCAGAAGGAGACACCTGAC GCGTCTATCCTGACCACCGTGCCTGGTCGAGACGTCGGGACCTCAG TCCTCGTCTCGGGGGGCCGAGGGTCGGGCGGCATCGGC GAGGACCGTGGCTCGCTCGGCGCTACTGTTACCGACG TAACACGAA...

Ngày tải lên: 23/03/2014, 03:20

12 371 0
w