báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot

báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot

báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot

... HCV transmission risk behaviours include injecting drugs, the sharing of injecting equipment, not cleaning and reusing drug paraphernalia, alcohol misuse, cocaine use, unpro- tected sexual activity, ... expectancies (expected con- sequences of a course of action, e.g. sharing injecting equipment) and self efficacy (confidence in one's ability to achieve a partic...

Ngày tải lên: 11/08/2014, 18:20

12 454 0
Tài liệu Báo cáo khoa học: Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity pptx

Tài liệu Báo cáo khoa học: Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity pptx

... malonyl-CoA, catalyzed by ACC – the key reg- ulatory enzyme in the pathway. Malonyl-CoA serves as the basic chain-elongating substrate for the formation of long-chain saturated fatty acids catalyzed ... increase in malonyl-CoA promotes a decrease in neuropeptide Y and agouti related peptide in hypo- thalamic malonyl-CoA while promoting an increase in proopiomelanocorti...

Ngày tải lên: 14/02/2014, 22:20

7 679 0
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

... rubripes; Brare, Danio rerio; Anoga, Anopheles gambiae; Drome, Drosophila melanogaster; Sacce, Saccharomyces cerevisi- ae; Schizo, Schizosaccharomyces pombe; Ciona, Ciona intestinalis; Caeel, Caenorhabditis ... variants of various lengths; each variant encodes distinct protein domain architectures that share a canonical bipartite nuclear localization signal and a PHD domain (Zn finger)...

Ngày tải lên: 07/03/2014, 21:20

7 658 0
Báo cáo khoa học: Monomeric molten globule intermediate involved in the equilibrium unfolding of tetrameric duck d2-crystallin pdf

Báo cáo khoa học: Monomeric molten globule intermediate involved in the equilibrium unfolding of tetrameric duck d2-crystallin pdf

... a surface with several convex and concave areas as indicated by a , ÔbÕ and c , which participate in subunit association. Two neighboring subunits (A and B) associated in a tail-to- head manner ... l M protein concentration. (B) The dynamic quenching constant (K SV ) and the fractional maxi- mum accessible protein fluorescence (f a ) verses GdnHCl. The intrinsic fluores...

Ngày tải lên: 08/03/2014, 08:20

8 426 0
Báo cáo khoa học: Cellular response to unfolded proteins in the endoplasmic reticulum of plants pptx

Báo cáo khoa học: Cellular response to unfolded proteins in the endoplasmic reticulum of plants pptx

... that accu- mulates in castor beans (Ricinus communis). The mature ricin comprises a catalytic A chain and a B chain linked by a single disulfide bond. The ER-tar- geted A chain is degraded by a ... is inhibited by the proteasome inhibitor clasto-lactacystin b-lactone, resulting in the accumulation of ricin A chains. These stabilized ricin A chains are partly deg...

Ngày tải lên: 16/03/2014, 11:20

20 439 0
Báo cáo khoa học: 2-Oxo acid dehydrogenase complexes in redox regulation Role of the lipoate residues and thioredoxin pot

Báo cáo khoa học: 2-Oxo acid dehydrogenase complexes in redox regulation Role of the lipoate residues and thioredoxin pot

... acids with branched carbon chain: Thus, the catalytic action of the 2-oxo acid dehydro- genase complexes directly in uences the NADH/NAD + ratio and involves the important biological SH/S-S com- pounds, ... CoA-induced inactivation, as the thioredoxin effect is related to alleviation of this inactivation. On the other hand, among 11 thioredoxin species with comparable activ...

Ngày tải lên: 17/03/2014, 09:20

7 407 0
Báo cáo khoa học: Succinate dehydrogenase flavoprotein subunit expression in Saccharomyces cerevisiae – involvement of the mitochondrial FAD transporter, Flx1p ppt

Báo cáo khoa học: Succinate dehydrogenase flavoprotein subunit expression in Saccharomyces cerevisiae – involvement of the mitochondrial FAD transporter, Flx1p ppt

... oligonucleotides were con- structed: S1-SDH1, 5¢-ATGCTATCGC TAAAAAAATC AGCGCTCTCC AAGTTGACTT TGCTCAGATT CGT ACGCTGC AGGTCGAC-3¢; and S2-SDH1, 5¢-TTAGT AGGCT CTTACAGTTG GAGGTACGGA AGGACAT TCC TTTTCGTCCA ... (5¢-TGCAATTAAA GAAG AGTATG ATATTCTTTT CCGTAAAATA CAATGAG- GTT CAAAGCATAG GCCACTAGTG GATCTG-3¢). The WT and EBY167-G418 S strains were transformed using the LiAc ⁄ SS Carrier DNA ⁄ P...

Ngày tải lên: 23/03/2014, 07:20

15 407 0
Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt

Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt

... using primers P4 (5¢-atgtagccattgtatttgaaaatgagcaact) and P5 ( 5¢- agttgctcattttcaaatacaatggctacat), and P6 (5¢- gaacagc cgtatttggccgcttattttgtatc) and P7 (5¢- gatacaaaataagcggccaaa tacggctgttc), ... (5¢-tacccatgtagtcgcagcgatcg ttgtttccgtaggg), and P10 (5¢-tgaagctggtgaattatcgattggtggagaa ggg) and P11 (5¢-cccttctccaccaatcgataattcaccagcttca), respec- tively. In order to combine all...

Ngày tải lên: 29/03/2014, 08:20

13 494 0
Báo cáo khoa học: "Hardness and basic density variation in the juvenile wood of maritime pine" ppt

Báo cáo khoa học: "Hardness and basic density variation in the juvenile wood of maritime pine" ppt

... V). Calculating the regressions with the mean value of each tree in each sentative of the second thinning in current man- agement practices. Both stands were located at the ... real latewood and a higher intra-ring homogeneity) and which can induce a dif- ferent behaviour during the indentation of the tool. It was again in thes...

Ngày tải lên: 08/08/2014, 14:21

13 468 0
Báo cáo khoa học: "Parotid gland-recovery after radiotherapy in the head and neck region: 36 months follow-up of a prospective clinical study" pdf

Báo cáo khoa học: "Parotid gland-recovery after radiotherapy in the head and neck region: 36 months follow-up of a prospective clinical study" pdf

... in the analysis. DV participated in the coordination. CG and TK conceived of the study, and participated in its design and coordination. All authors have approved the final manuscript. Acknowledgements ... squamous cell carcinoma of the head and neck were included in a prospective, non -randomised clinical study. These patients represent a cross-secti...

Ngày tải lên: 09/08/2014, 09:21

25 343 0
Từ khóa:
w