báo cáo khoa học: " Retail promotions and perceptions of R J Reynolds’ novel dissolvable tobacco in a US test market" pdf
báo cáo khoa học: " Retail promotions and perceptions of R.J. Reynolds’ novel dissolvable tobacco in a US test market" pdf
... Study find- ings also suggest that promotions, especially those aimedattrial(i.e .in- storeadsandin-barpromotions) play a major role in creating awareness and product trial. In- store and bar promotions ... as targeting smokers. However, consumer awareness of Camel Dissolvables during test marketing was very low; males and current and former smokers had greater awareness,...
Ngày tải lên: 11/08/2014, 18:20
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... 3¢-end of HCV minus-strand RNA as they were also present when RNA fragments of the 3¢UTR were used as templates. Data from RdRp assays performed in the presence of heparin indicated that these products ... provided by A. Martin (Institut Pasteur, Paris, France). The primers used were VB1: 5¢-AAACATATGA GCATGAGCTACCACCTGGACC-3¢ and VB3: 5¢-CTCG AGCTTCACAAGAAACTTCTGC-3¢. The PCR frag...
Ngày tải lên: 20/02/2014, 01:20
báo cáo khoa học: "The occurrence and management of fluid retention associated with TKI therapy in CML, with a focus on dasatinib" pptx
... International randomized study of interferon versus STI571 (IRIS) 7-year follow-up: sustained survival, low rate of transformation and increased rate of major molecular response (MMR) in patients ... therapies, dasatinib and nilotinib, are available for CML patients who are resistant to or intolerant of imatinib therapy. Although the newer TKIs are similar, there are differences...
Ngày tải lên: 10/08/2014, 22:20
Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx
... at zero time (100%). Error bars are standard deviations for data from three separate experiments. Asterisks indicate error bars representing mean ± one-half the range from two separate experiments. ... 240-min data are from a single experiment, and error bars represent range of duplicate determinations. Error bars in 60-min curves represent mean ± one-half the range from two independe...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... CGAGCAGGAGATGGGAACC Real-time PCR Zfbactin -R CAACGGAAACGCTCATTGC Real-time PCR Zfgapdh-F CGCTGGCATCTCCCTCAA Real-time PCR Zfgapdh -R TCAGCAACACGATGGCTGTAG Real-time PCR ZFil4-F CATCCAGAGTGTGAATGGGA Real-time ... 5¢-RACE Zf5¢stat6 -R2 GGACTGACATTGCTCCAGAGC 5¢-RACE Zf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACE Zf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC 3¢-RACE Zftbet-F1 CTCCCTCAAACAAACCAGAGTC Initi...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf
... 5¢-CG TTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CA CAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi- trogen Corporation) and reverse primers 5¢-AAGTAGGCA ACAAAACAACG-3¢ and 5¢-GTTTTCCCGACAATAA- CATGG-3¢ were used for detecting ... b-conglycinin and glycinin, as pro-b-conglycinin and proglycinin are transient pro- tein forms that are present in the ER prior to process- ing in the protein stor...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: SREBPs: physiology and pathophysiology of the SREBP family ppt
... M, Kumadaki S, Matsuzaka T, Nakagawa Y, Yahagi N, Nakakuki M, Hasty AH et al. (2008) Palmitate impairs and eicosapentaenoate restores insulin secretion through regulation of SREBP-1c in pancreatic islets. ... development of ventricular arrhythmia, especially after myocardial infarction, could be regulated by myocardial SREBP-1c, indicating a relationship between lipid metabolism an...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf
... binding of ligand to a type II receptor, a transmembranous serine ⁄ threonine receptor kinase. The ligand–type II receptor complex recruits another serine ⁄ threonine transmembrane receptor kinase, ... Growth Factor Rev 12, 305–312. 12 Beall MJ & Pearce EJ (2001) Human transforming growth factor-beta activates a receptor serine ⁄ threonine kinase from the intravascular parasite Sc...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc
... among hubs are retained. Acknowledgements Thanks to Dr J. Aldana-Montes and members of Kha- os group research of the University of Ma ´ laga for their help in data acquisition. Thanks to P. Fernandez and S. ... binding factors involved in the NFjB pathway and other func- tional related factors, such as p300 and CBP. Group D contain factors related to cell cycle and DNA re...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Antifungal effects and mechanism of action of viscotoxin A3 docx
... low viscotoxin concentration as concentrations greater than 1 lm always led to seal breakdown. Pyrularia thionin and b-purothionin are also capable of lysing cell mem- branes, indicating that thionins in ... fluxes of Ca 2+ in Neurospora crassa hyphae [42]. We found that VtA 3 induced an increase in internal Ca 2+ concentration, this Ca 2+ probably being liberated from internal sto...
Ngày tải lên: 19/02/2014, 07:20