Báo cáo y học: " Liposarcoma of the forearm in a man with ty

Báo cáo y học: " Liposarcoma of the forearm in a man with type 1 neurofibromatosis: a case report" ppsx

... literature [4–8]. We present a case of forearm liposarcoma in a patient with NF1. Case presentation A 41- year-old Caucasian man, known to have generalized NF1 since the age of 21, presented at ... analyzed and interpreted the patient data regarding the NF1 and liposarcoma. MDS carried out the operation on the patient and was the main contributor in the...

Ngày tải lên : 11/08/2014, 17:21

5
266
0

Báo cáo Y học: Interaction of the anterior fat body protein with the hexamerin receptor in the blowﬂy Calliphora vicina pot

... ABP130-5¢(CTCGAGGGTGTTATAATGG ATCGAGGTGGACGAGT)/ABP130-3¢ (CTC GAG ATTCAATTATTTAGTACAAATGGCTAAGAGG CATTT); (2) ABP96: ABP130-5¢/ABP96-3¢ (CTCGAGAGGCAAC AACAGACGATGAGGCAACTTA); (3) ABP64: ABP130-5¢/ABP64-3¢(CTCGAGACCAGA GATCTCATCATTATCATTGTAATT). XhoI ... (twice) as baits. We also examined the ability of AFP to interact with ABP130, ABP96, and ABP64 in the two-hybrid assay. We found...

Ngày tải lên : 08/03/2014, 22:20

7
408
0

Báo cáo y học: "Association of the microsatellite in the 3'''' untranslated region of the CD154 gene with rheumatoid arthritis in females from a Spanish cohort: a case-control study" ppsx

... (Canary Islands, Spain). The median age at onset of RA was 45 years (interquartile range 27 to 63 years) and the median disease duration was 13 years (interquartile range 2 to 24); 74% of the ... in patient and control groups in contingency tables to test whether the association of any variable with RA depended on the presence of any other variable. This analysis reve...

Ngày tải lên : 09/08/2014, 10:21

11
454
0

Báo cáo y học: "Malakoplakia of the appendix, an uncommon entity at an unusual site: a case report" docx

... includes an intriguing case of malakoplakia of the appendix associated with the eggs of Taenia species [5]. Although gastrointestinal malakoplakia is associated with a variety of conditions including ... sheets and aggre- gates of histiocytes (von Hansemann cells) with fine eosinophilic granular cytoplasm are seen on haematoxy- lin and eosin stain. They are characteris...

Ngày tải lên : 11/08/2014, 23:21

3
259
0

Báo cáo y học: " Survivors of the war in the Northern Kosovo: violence exposure, risk factors and public health effects of an ethnic conflic" pdf

... Stone AA: Assessment of pain: a community-based diary survey in the USA. Lancet 2008, 3 71( 9623) :15 19 -15 25. 28. Gagliese L: Pain and aging: the emergence of a new subfield of pain research. J Pain ... tortured. Patterns of social and political participation in a family could affect the proportion of family members complaining of pain. The proportion of...

Ngày tải lên : 13/08/2014, 14:20

16
310
0

Báo cáo y học: "Validity of the International Physical Activity Questionnaire Short Form (IPAQ-SF): A systematic review" docx

... Sports and Exercise 2000, 32:S450-S456. 28. Ishikawa-Takata K, Tabata I, Sasaki S, Rafamantananatsoa HH, Okazaki H, Okibo H, Tanaka S, Yamamoto S, Shirota T, Uchida K, Murata M: Physical activity ... evaluate public health or individual interventions aiming at increasing levels of physical activity, reliable and valid measures of habitual physical activity are essential. Several rout...

Ngày tải lên : 14/08/2014, 08:21

40
299
0

Báo cáo y học: "Treatment of psychotic symptoms in bipolar disorder with aripiprazole monotherapy: a meta-analysis" pps

... Anxiety Agitation Acathisia Constipation Headache Hyperprolactinaemia Insomnia Nausea Sedation CN138-009 Mania 8 1 9 7 5 -6 6 13 15 CN138-074 Mania 6 2 0.4 13 .1 6.5 0.2 -7 5.5 9.4 CN138 -13 5 Mania ... Richter Acknowledgements KNF had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data ana...

Ngày tải lên : 08/08/2014, 23:21

10
548
0

Báo cáo y học: " Genotyping of TRIM5 locus in northern pig-tailed macaques (Macaca leonina), a primate species susceptible to Human Immunodeficiency Virus type 1 infection" pps

... ……cggggtttccccatggttaggctcgtctagaactcctgacctcaggtgatccacccgcctcggcctgcc aaagtgctgggattacaggcatgagctaccgcgcccagcctgtgcttattttcttaaaataatttttgtgg ctttgcag/ACGCTGCCGCCGAGGAAAGTCCTGTACTACTAGCCATGGTCAACCCTACCGTGTTCTTCGAC ATTGCCGTCGACGGCGAGCCCTTGGGCCGCGTCTCCTTCGAGCTGTTTGCAGACAAGGTTCCAAAGACAGC AGAAAATTTTCGTGCTCTGAGCACTGGAGAGAAAGGATTTGGTTATAAGGGCTCCTGCTTTCACAGAATTA TTCCAGGGTTTATGTGTCAGGGTGGTAACTTCAC...

Ngày tải lên : 12/08/2014, 23:21

12
240
0

Báo cáo y học: "Compression of the median nerve in the proximal forearm by a giant lipoma: A case report" docx

... history of gradually worsening numbness and paresthesia on the palmar aspect of the left thumb and thenar eminence. Clinical examination reveals a hypoaesthesia in the median nerve area of the ... relation with the neck of the radius) [8 ,15 -19 ], and a few cases of ulnar nerve compression in the forearm [11 ] and the Guyon's canal [20-22]. The in...

Ngày tải lên : 10/08/2014, 10:20

4
383
0

Báo cáo y học: "Use of the measure your medical outcome profile (MYMOP2) and W-BQ12 (Well-Being) outcomes measures to evaluate chiropractic treatment: an observational study"

... coordination. BP, AK and MW supervised the student chiropractors in the collection and analysis of data. MJW undertook a further overall statistical analysis of data and drafted the manuscript. All ... as shown in Table 3. TheMYMOP2scalesofSymptom1andProfile showed a moderate negative correlation with the General Wellbeing (GWB) and Energy scales of the W-BQ12. The...

Ngày tải lên : 25/10/2012, 10:06

8
538
0