Báo cáo Y học: Interaction of the anterior fat body protein with the hexamerin receptor in the blowfly Calliphora vicina pot

Interaction of the anterior fat body protein with the hexamerin receptor in the blowfly Calliphora vicina Immo A. Hansen, Susanne R. Meyer, Ingo Scha¨ fer and Klaus Scheller Department of Cell and Developmental Biology, Biocenter of the University, Wu ¨ rzburg, Germany In late larvae of the b lowfly, Calliphora v icina, a rylphorin and LSP-2 p roteins, which belong t o the class of hexamerins, are selectively t aken up by the fat body from the h aemolymph. Hexamerin e ndocytosis is mediated by a specific membrane- bound receptor, the arylphorin-binding protein (ABP). Using the two-hybrid technique, we found that the anterior fat bodyprotein ( AFP) interacts with the hexamerin receptor. AFP, a homologue of the m ammalian c alcium-binding liver protein regucalcin ( sene scence marker protein-30), exhibits a strong binding affinity for a naturally occurring C-terminal cleavage fragment of the hexamerin receptor precursor (the P30 p eptide) and other receptor c leavage products that contain P30. Expression of AFP mRNA and protein is restricted to the anterior part of the fat b ody tissue and to haemocytes in last-instar larvae. AFP mRNA occurs in all postembryonic developmental stages. Our r esults suggest that AFP p lays a r ole in t he r egulation of hexamerin uptake by fat body cells along the a nterior–posterior axis. Keywords: anterior f at body protein; Calliphora v icina; cDNA sequence; he xamerin r eceptor; yeast t wo-hybrid system. The construction of adult tissues during the metamorphosis of holometablous insects requires large amounts of energy and building blocks. Before formation of the puparium, fat body cells reabsorb proteins and other macromolecules t hat have accumulated in the haemolymph during t he larval feeding period. The major fraction of incorporated proteins consists of arylphorins a nd LSP-2 which belong to the class of hexamerins, haemocyanin-related proteins, named according to their composition of six identical or closely related subunits [1]. Although some studies suggest that a nonspecific, general protein uptake mechanism is responsi- ble for the incorporation of hexamerins [2], the se lectivity of this process has been demonstrated unambiguously by the differential clearing of distinct proteins from the haemol- ymph [3–6]. Transport of h examerins t hrough f at body cell membranes is controlled by ecdysteroids and mediated by a specific receptor (for review, see [7]). The hexamerin receptor of Calliphora vicina was c loned and its post- translational processing studied in detail. Two c leavage steps, which d etach a 45-kDa and a 30-kDa peptide from the h examerin-bin ding N- terminus of the receptor p recursor (Fig. 1 ), have been shown to be connected to activation of the receptor and initiation o f hexamerin endocyto sis [8,9]. The principal cell type of the fat body is the trophocyte, which is morphologically uniform and has long been thought to have equivalent functions. Almost all experiments dealing with protein expression a nd sequestration by this tissue have been performed using the entire fat body [10,11]. However, in both Diptera and Lepidoptera, data are accumulating that show regional differences in fat body function. In the corn earworm, Helicoverpa zea, storage proteins are synthesized by the peripheral fat body fraction, but are taken up and stored only by the perivisceral f at body [12]. In the silkworm, Bombyx mori, it has been demonstrated that dorsal and ventral perivisceral f at body contains the most competent cells for sequestering h aemolymph proteins c ompared with peripheral and hind-gut associated fat body tissue [ 13]. In dipteran insects, differences in both composition and fate of the anterior and posterior fat body have been reported. The larval fat body of the fruitfly, Drosophila melanogaster, a nd the blue b lowfly, Calliphora vicina,is organized into a lobed tissue of  2000–3000 polytene cells, which become dissociated from each other during meta- morphosis. Roughly half of the cell population survives metamorphosis, indicating a specific degree of differentia- tion during postembryonic life [ 14,15]. An increase in the number of storage protein granules found along the anterior–posterior axis has been described in the fruitfly Drosophila [16], and rapid degradation of the anterior part of the fat body tissue after pupariation has been reported in the fleshfly Sarcophaga peregrina [17]. The authors report the specific expression of anterior fat body protein (AFP) in the trophocytes of the anterior fat body of S. peregrina, demonstrating one of the biochemical differences in dipteran fat body tissue. Here we report t he tissue-specific expression of AFP and its interaction with the h examerin receptor. This is the first demonstration of a protein–protein i nteraction of the hexamerin receptor with a nonh exameric partner. EXPERIMENTAL PROCEDURES Experimental animals AstrainofC. vicina that has been maintained in our laboratory for several decades was used. T he flies were Correspondence to I. A. Hansen, Medizinische Polyklinik der Universita ¨ t, Endokrinologie, Josef-Schneider-Str. 2, D-97080 Wu ¨ rzburg, Germany. E-mail: i.hansen@medizin.uni-wuerzburg.de Abbreviations: ABP, arylphorin-binding protein; AFP, anterior fat body protein; NBT/BCIP, nitroblue tetrazolium chloride/5-bromo- 4-chloro-3-indonyl phosphate (Received 22 June 2001, revised 22 October 2001, accepted 7 December 2001) Eur. J. Biochem. 269, 954–960 (2002) Ó FEBS 2002 reared o n bovine meat a t 25 °C and relative humidity of 65% as previously described [18]. Preparation of fat body tissue and haemocytes Third-instar larvae were washed in insect saline and anaes- thetized by cooling on ice for a few minutes. The larvae were dissected by a medial cut, washed with cold insect saline, and the fat body tissues excised. For the isolation of haemocytes, anaesthetized larvae were dried a nd tr ansferred t o a cold microscope slide. From a small cut in the abdomen, haemolymph (5–10 lL per larva) was collected by pipette and transferred to a 1.5-mL Eppendorf t ube on ice. After centrigugation at 3000 r.p.m. at 4 °C, the supernatant was removed and the pellet containing the h aemocytes w as washed twice with ice-cold insect saline and re-centrifuged. Two-hybrid library construction Total RNA was isolated from dissected fat body tissues of third-instar larvae (6–7-day-old larvae) using Trizol reagent (Gibco) following the supplier’s instructions for fatty tissues. One microgram of total RNA was used for cDNA synthesis with the SMART TM PCR cDNA Library Construction Kit (Clontech, Heidelberg, Germany). T he cDNA obtained included two different SfiI rest riction sites at the 5¢ and 3¢ ends (SfiI/A, Sfi I/B). The two-hybrid library vector pJG4-5 (GenBank accession number U89961) was modified b y introducing the Sfi I/A and Sfi I/B r estriction sites i nto its multiple colo ning site allowing directed cloning of the cDNA. The ligation reaction was c arried out overnight at 16 °C. The library plasmids were transformed in Escherichia coli XL1-Blue cells via electroporation and grown on Luria– Bertani plates containing ampicillin. A total of 1.2 · 10 6 independent bacterial clones were obtained and subjected to plasmid isolation using the QIAfilter Plasmid Mega Kit (Qiagen, Hilden, Germany). One milligram of library plasmids was isolated. The cDNA library contains  3.8 · 10 5 individual clones in the correct reading frame. The average insert size was 1 kbp. Construction of hexamerin receptor bait proteins for two-hybrid screening Three h examerin receptor bait plasmids wer e constructed according t o t he natural receptor cleavage products ABP130, ABP96, ABP64 described previously [9] (Fig. 1). Using a pBluescript S K+ vec tor bearing t he complete hexamerin receptor cDNA sequence (GenBank accession number X79100) as a template, three cDNA fragments were amplified via PCR u sing different primer combinations: (1) ABP130: ABP130-5¢(CTCGAGGGTGTTATAATGG ATCGAGGTGGACGAGT)/ABP130-3¢ (CTC GAG ATTCAATTATTTAGTACAAATGGCTAAGAGG CATTT); (2) ABP96: ABP130-5¢/ABP96-3¢ (CTCGAGAGGCAAC AACAGACGATGAGGCAACTTA); (3) ABP64: ABP130-5¢/ABP64-3¢(CTCGAGACCAGA GATCTCATCATTATCATTGTAATT). XhoI restriction sites were attached at the 5¢ ends of the primers. PCR was carried out using P fuTurboÒ DNA Polymerase (Stratagene, La Jolla, CA, USA) following the manufacturer’s protocol. The P CR products were sub- cloned in p CR-Script Amp vector (PCR-Script TM Amp Cloning Kit; Stratagene), excised with XhoI, and finally ligated in the two-hybrid bait vector p EG202 ( Origene, Rockville, MD, USA). The orientation and correct insertion were checked by sequencing u sing the pEG202-seq primer. Two-hybrid screening This was c arried out f ollowing a s tandard protocol for LexA-based two-hybrid systems [ 19]. Thirty-one library plasmids that interacted with the b aits were isolated from the yeast and transferred into E. coli XL1-blue cells and sequenced from the 3 ¢ and 5¢ endonaPerkin–Elmer310 sequencer using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (P erkin–Elmer). 5¢ RACE 5¢ RACE was p erformed using the SMART TM RACE cDNA Amplification Kit (Clontech, Alameda, CA, USA) following the manufacturer’s instructions. Two specific primers were u sed (P1: 5 ¢-GCCATCGGGCAACAAAT GATCCTTGGGGCTGGTCTTG-3¢;P2:5¢-GATCGG TTGTACCTTCGACGGGCACAGCAAAACCA-3¢,see Fig. 3). Northern-blot hybridization Total RNA was extracted from freshly prepared t issues using the TriFast Kit (Peqlab, Erlangen, Germany) and subjected to electrophoresis in a 0.8% agarose gel. North- ern-blot analysis was performed according t o standard procedures [20]. A s a hybridization probe, we u sed a digoxygenin-labeled antisense R NA, s ynthesized from Fig. 1. S cheme of the post-translational cleavage pattern of the Calli- phora h examerin r eceptor [7,9]. The primary translation product con- tains a 17-amino-acid N -termin al signal p eptide which is removed immediately after translation. Before reaching the cell membrane, the receptor precursor is cleaved a second time: a 429-amino-acid C-ter- minal fragment is removed, giving rise to P45 and ABP96 (807 amino acids) which comprises the active receptor. The onse t of arylphorin reabsorption by the fat bo dy coincides with a third receptor cleavage which generates ABP64 (554 amino acids) and P30 (253 amino acids). Only ABP 130, ABP96 and P30 are able to b ind hexamerins. Ó FEBS 2002 Calliphora anterior fat body protein (Eur. J. Biochem. 269) 955 linearized A FP cDN A as template using t he DIG-RNA- Labeling Kit (T7; Roc he Molecular Biochemicals, Mann - heim, G ermany). Immunodetection w as carried out using antibodies to DIG coupled with peroxidas e. The blots w ere developed b y the nitroblue tetrazolium chloride/5-bromo- 4-chloro-3-indonyl phosphate (NBT/BCIP) metho d. In situ hybridization on cryosections Seven-day-old anaesthetized larvae received injections of 5 lL 4% paraformaldehyde in NaCl/P i (7 m M Na 2 HPO 4 , 3m M NaH 2 HPO 4 , 130 m M NaCl) a nd were fixed overnight in paraformaldehyde/NaCl/P i at 4 °C. The fixed larvae were incubated at 4 °C f or 24 h i n Ringer solution (130 m M NaCl, 4.7 m M KCl, 0.74 m M KH 2 HPO 4 ,0.35m M Na 2 HPO 4 ,1.8m M MgCl 2 , p H 7.0) c ontaining 25% sucrose. Longitudinal cryosections (10 lm) were incubated for 5 min in 0.1 M glycine/Tris/HCl buffer (pH 7.0) and successively for 15 min at room temperature in NaCl/P i containing 0.3% Triton X-100. After three wash s teps with NaCl/P i , the sections were fixed for 2 min in 2% paraform- aldehyde and then for 10 min in 10 m M Tris/HCl/1 m M EDTA (pH 7.4). After a 1-h prehybridization, the heat- denatured DIG-labeled AFP-antise nse RNA probe was added for hybr idization overnight at 42 °C. The slides were washed according to the following scheme: 3 · 10 min with 4 · NaCl/Cit; 2 · 10minwith2· NaCl/Cit; 1 0 min with 0.1 · NaCl/Cit; 10 min with 0.05 · NaCl/Cit; 5 min with NaCl/Tris. After incubation for 30 m in in nonfat dried milk-saturated NaCl/P i , the slides were incub ated for 2 h at 37 °C with antibodies to DIG. After three washes with NaCl/Tris, the reactive structures were visualized by the NBT/BCIP method. The specimens were mounted in Mowiol and analyzed under t he microscope. Whole-mount in situ hybridization Last-instar larvae were dissected in ice-cold insect saline by a cut at the posterior end and upending the c omplete larvae. The gut was removed and the preparations promptly fixed in MEMFA (0.1 M Mops, 2 m M EGTA, 1 m M MgSO 4 , 3.7% formaldeh yde) for 2 h at room temperature. The tissues were dehydrated with methanol and s tored at )20 °C until used for whole-mount in situ hybridization [21]. Immuno-coprecipitiation with AFP and ABP antibodies The anti-ABP IgG recognizes the hexamerin (arylphorin) receptor of C. vicina [5]. The anti-AFP IgG was provided by Dr Nakajima and recognizes a 34-kDa AFP in S. peregrina [17]. Protein A–Sepharose CL-4B (Ph arma Biotech, F rei- burg, Germany) was s uspended in NaCl/P i . The resulting gel was centrifuged at 1000 g and resuspended in 1 vol. NaCl/P i (SL). Anterior fat body tissue from 8-day-old larvae was homogenize d in NaCl/P i containing 0.05% phenylthiourea and centrifuged for 5 min at 8000 g at 4 °C. The s upernatant was used for immunoprecipitation. SL (50 lL) was incu bated in an Eppendorf cap with 5 lganti- ABP IgG at 4 °C for 4 h. Then, 500 lL fat body supernatant or 500 lL haemocytes was added a nd incuba- ted at 4 °C overnight. As controls, anti-(rabbit LexA) IgG was a dded as an antibody or NaCl/P i was u sed instead of homogenate. The incubation mixtures were centrifuged and the pe llet washed eight times with NaCl/P i . The last pellet was suspended in 30 lL s ample buffer, heated at 95 °Cfor 2 min, and centrifuged. The s upernatant ( 15 lL) was subjected to SDS/PAGE. Western-blot analysis For i mmunoblots, the heat-denatured proteins were trans- ferred to poly(vinylidene difluoride) membranes (Millipore Corp., Bed ford, MA, USA). The membranes were blocked with 10% nonfat dried milk/0.3% Tween 20 in NaCl/Tris and incubated with anti-AFP IgG (0.5 lgÆmL )1 in NaCl/ Tris containing 1% BSA) for 2 h at room temperature. After three washes in NaCl/Tris, the secondary antibody (goat an ti-rabbit IgG conjugated with alkaline phosphatase, diluted 1 : 7500; Promega, Heidelberg, Germany) was added and the blots were incubated for 1 h. After three washes, the blots were developed with NBT/BCIP system as described under Northern-blot hybridization. Immunofluorescence analysis Longitudinal cryosections (10 lm) from the same larvae as used for in situ hybridization were blocked at room temperature for 2 h with 3% normal g oat s erum in 0.5 · PAT ( 1 · NaCl/P i , 1% albumin, 0.5% Triton X-100) and then incubated overnight at 4 °C with anti-AFP IgG (10 lgÆlL )1 in 0.5 · PAT). A fter three washes with NaCl/P i , t he sections were incubated for 2 h at room temperature with a Cy2 (cyanine 2-OSu bisfunctional)- conjugated affinity-purified goat anti-rabbit IgG (1 : 50; Rockland, Gilbertsville, PA, USA) in 0.5 · PAT. After being thoroughly washed, the sections were analyzed under a Leica fluorescent microscope and photographed with a Pixera CCD camera. The specificity of the AFP immuno- reaction was verified by omitting the primary antibody. RESULTS Screening for interaction with hexamerin receptor Using the yeast two-hybrid s ystem and ABP 130, as well as ABP 96 (Fig. 1) as a bait, we isolated 27 Ôinteraction positiveÕ yeast clones. The library (prey) plasmids of these clones was isolated. S equence analysis of the cDNAs revealed that 17 were hexamerin cDNAs ( 14 arylphorin and three LSP-2), confirming the ability of the experimental system to identify proteins that interact with the hexamerin receptor. Thirteen of the library plasmids contained cDNAs that encoded nonhexamerin interactors. In our database search using BLAST X analysis, nine showed no homology to a ny known protein. We identified three cDNAs that encoded a protein with 93% identity in the deduced amino-acid sequence with the A FP of S. peregrina (GenBank accession number BAA99282). Because of the high sequence identity with the Sarcophaga AFP, we named our clone Calliphora AFP (GenBank accession number AY028616). The AFP clones were identified by screening the prey library with ABP130 (once) or ABP96 (twice) as baits. We also examined the ability of AFP to interact with ABP130, ABP96, and ABP64 in the two-hybrid assay. We found a strong interaction between AFP and ABP130 and ABP96, but no interaction with ABP64 (Table 1). 956 I. A. Hansen et al.(Eur. J. Biochem. 269) Ó FEBS 2002 Immuno-coprecipitation of AFP and hexamerin receptor To confirm the results d emonstrating the interaction of AFP with different cleavage products of the hexamerin receptor, w e used immuno-coprecipitation as an indepen- dent method. AFP could be precipitated w ith anti-ABP IgG and the receptor (ABP) with anti-AFP IgG. A s can be seen from Fig. 2, anti-AFP IgG precipitated the receptor cleavage f ragment P 30, whereas anti-ABP IgG precipitated AFP. Isolation and sequence analysis of full-length AFP cDNA The deduced peptide sequences of the isolated AFP cDNAs did not contain a start methionine and were lacking 40 amino acids at the N-terminus compared with the AFP of S. peregrina (GenBank accession number BAA99282). 5¢-RACE PCR led to an overlapping fragment of 288 bp. The complete 1 150-bp AFP cDNA obtained (GenBank accession number AY028616) had an O RF of 921 bp starting with an ATG c odon at postion 42 and ending with a TAA codon at position 962 (Fig. 3). The predicted protein is composed of 306 amino acids, with a calculated molecular mass of 34.3 kDa and a pI of 5.72. Similar searches with the deduced amino-acid sequence of f ull-length Calliphora AFP, tested against the SwissProt database, showed a 93% pairwise amino-acid identity and 97% positivity with the AFP of S. peregrina, and, furthermore, a 75% identity and 85% positivity with the AFP o f D. melanogaster (GenBank accession number JC7250). The presence of a stop codon at position 33 in the AFP cDNA ()9 from t he start c odon) explains why we were not able to isolate a full-length cDNA by two-hybrid screening. A stop codon at this position interrupts the synthesis of a two-hybrid fusion protein, if the f ull-lenth c DNA is ligated in the library plasmid. Stage-specific and tissue-specific appearance of AFP We tested the Sarcophaga antibody to AFP for its ability t o recognize a similar protein in Calliphora by immunoblot analysis. As s hown in F ig. 4, a 34-kDa protein w as recognized in the a nterior as w ell as the central, but not the posterior, part of the fat body (Fig. 4 B). A clear signal was also detected in the haemocytes. The apparent molec- ular mass of the detected AFP band (34 kDa) corresponds well to that calculated from the a mino-acid sequence (34.4 kDa). Northern-blot analysis confirms th e presence o f strongly enriched AFP mRNA (1.2 kbp) in the anterior part of t he fat body of last-instar larvae (Fig. 5B). The mRNA was also present in pupae and adults (Fig. 5 A), as well a s in haemocytes of last-instar larvae (Fig. 5B). The r esults obtained by i mmunoblot and Northern- blot analysis were confirmed b y immunofluorescence (Fig. 6 A–C), in situ hybridization of cryosections (Fig. 6D), and whole-mount in situ hybridization (Fig. 6E,F). A sharp border could b e detected b etween flu orescent cells of the anterior fat body lobe and nonfluorescent cells of the central lobe in the immunofluorescence experiment (Fig. 6 A). The whole-mount in situ hybridization revealed that the AFP mRNA transcription in the fat body is almost exclusively restricted to the anterior lobes in l ast-instar larvae (Fig. 6E,F). Haemocytes were sho wn to express the AFP mRNA (Fig. 6D) and t o synthesize t he AFP protein (Fig. 6C). Western b lots, using an antibody that recognizes the receptor fragments ABP96, ABP64, P45 and P30, showed that the h examerin receptor is pr esent in a ll fat body fractions but not in the haemocytes (Fig. 4A). Fig. 2. Immuno-coprecipitation o f AFP and the Calliphora hexamerin receptor by a ntibodies to ABP and AFP demonstrated by Western b lotting. (A) Proteins were separated by SDS/PAGE (10% ge l), transferred to membrane filters, and probed with a polyclonal anti-AFP I gG. Fat b ody extract from 7-day-old larva (H). Fat body proteins after immunoprecipitation with hexamerin receptor antibody (anti-ABP IgG); proteins derived from p osterior fat body (pF), or anterior fat b ody (aF). Controls: K1 ¼ aF, omitting anti-ABP IgG precipitation; K 2 ¼ a F using anti-(LexA) IgG instead of anti-AFP IgG; K3 ¼ buffer instead of fat bo dy homogenate. The stained 34-kDa band represents AFP. AB ¼ anti-ABP or anti- LexA (K2), r espectively. (B) The separate d proteins were probed with a polyclo nal anti-ABP IgG. a F ¼ p roteins from anterior fat body after immunoprecipitation with anti-AFP IgG. The stained 30-kDa band represents P30. AB ¼ anti-AFP. Visualization of the bands was with a secondary anti-rabbit antibody coupled with alkaline phosphatase followed by NBT/BCIP colour reaction. Table 1. I nteraction of AFP with different fragments of the hexamerin receptor (see Fig. 1) in a two-hybrid experiment. AFP binds to ABP130 and ABP96 but not ABP64. The hexamerin, arylphorin, used as a positive control, binds to all receptor fragments. Bait Library plasmid (Prey) Reporter gene Leu2 lacZ ABP130 AFP + + ABP96 AFP + + ABP64 AFP – – ABP130 Arylphorin + + ABP96 Arylphorin + + ABP64 Arylphorin + + Ó FEBS 2002 Calliphora anterior fat body protein (Eur. J. Biochem. 269) 957 DISCUSSION AFP, a binding partner of the hexamerin receptor The fat body is the biochemically most active organ in insects, with multi ple functions such as metabolism o f proteins, carbohydrates and lipids, particularly blood sugar and haemolymph proteins, such as vitellogenins and hexamerins. The fat body corresponds functionally, a t least in p art, to the liver of verte brates. Therefore, this insect organ is a highly suitable tissue for studies of the stage-specific and t issue-specific expression of genes, post- transcriptional r egulation of RNA, and post-translational control of p rotein bio synthesis. On e of the most detailed investigations of fat body proteins has b een the metab- olism of the storage protein arylphorin, which belongs t o the class of hexamerins [5–9]. These proteins are synthe- sized in a stage-specific manner and reabsorbed by the fat body. Hexamerin uptake has been shown to be due to receptor-mediated endocytosis. As in all other dipteran insects i nvestigated so far, the hexamerin receptor of C. vicina is subjected to threefold post-translational cleav- age, which succesively results in the active receptor involved in endocytosis. T he last cleavage step is initiated by ecdysteroids, the hormone acting at the post-transla- tional l evel [7,9]. Fig. 4. Tissue-specific appearance of AFP and the hexamerin receptor. (A) Extracts of a nterior ( aF), c entral ( cF), po sterior (pF) f at b ody, hae- mocytes (H) and cell-free ha emolyph (s) were analyzed by S DS/PAGE (8% gel) and probed with a polyclonal anti-ABP antib ody using the BCIP/ NBT colour reaction. The cleavage fragments (ABP96, ABP64, P45, P30) of the hexamerin receptor can be observed e xclusively in the fat body but not in the haemocytes and haemolymph. (B) Same protein samples as in (A) probed with an anti-AFP IgG. Large amounts of the 34-kDa protein (AFP) can be detected in the anterior part of t he fat body (aF); substantial l ess protein is found in the cen tral (cF) fat body and no AFP in t he posterior fat body (pF) and within the cell-free haem olymp h (s). AFP can also be observed in the haemocytes ( H). Fig. 3. Nucleic acid and deduced amino-acid sequences of the cDNA encoding Calliphora AFP. The specific primers used for RACE PCR are underlined, and the additional N-terminal sequence obtain ed by 5¢ RACE is enclosed in shaded boxes. Start and termina- tion codons are in bold letters, and the putative polyadenylation signal is double- underlined. 958 I. A. Hansen et al.(Eur. J. Biochem. 269) Ó FEBS 2002 Looking for binding partners of the hexamerin receptor, we constructed and screened a cDNA library of C. vicina RNA from fat body by two-hybrid assays. In addition to the conversant interactors arylphorin and LSP-2, which belong to the hexamerin family, we identified AFP as a strong interactor. T he two-hybrid analysis and the results of t he immuno-coprecipitation revealed that AFP i nteracts with P30 and with all cleavage products of the hexamerin receptor that contain this peptide (AB P130, ABP96), whereas shorter N-terminal fragments of the receptor that do not include P30 show no interaction with AFP (Table 1). Thus, three cleavage products are possible interactors in vivo: ABP130, ABP96 and P30. However, significant interaction of AFP and peptides derived from the hexamerin receptor precursor can only take place in the anterior l obe of the fat body because of the large amounts of AFP in this tissue. Expression of AFP in C. vicina As in almost all experiments dealing with protein expression and sequestration, these s tudies were performed using the entire fat body. Here we show that AFP is exclusively expressed in the anterior pair of fat body lobes of last-instar larvae, and the median and posterior lobes appear to be free from AFP. This region-specific expression pattern a lso resembles that reported for S. peregrina [17]. As the anterior part of the fat body is in contact with the ring gland, the ecdysteroid-producing organ, its function may be more under endocrine control t han t he central and posterior parts, which are provided with hormones circulating in the haemolymph. In addition to its exp ression in t rophocytes of the anterior fat body, AFP was found to be present in another cell type. Larval haemocytes contain substantial amounts of A FP mRNA (Fig. 5B) and AFP protein (Fig. 4 B). A s t hese cells never express the hexamerin receptor (Fig. 4A), AFP must have different functions in the two cell types. Cell-free haemolymph preparations were negative, indicating that AFP is not secreted into the haemolymph. AFP does not contain a transmembrane transport s ignal peptide. Fig. 5. Northern blot demonstrating the stage-specific and tissue-specific appearance of AFP mRNA. (A) Stage specificity of AFP mRNA expression. Total fat b ody RNA (20 lg) isolated from different developmental stages was applied to each slot. A digoxygenin-labeled antisense AFP RNA probe was used with an alkaline phosphatase- linked anti-digoxygenin IgG. Hybridization resulted in a distinct b and at 1.2 kb. RNA was derived from l ast-instar larvae (4–7: 4–7-day-old larvae), prepupae (V), and pupae (P ). Adult flies (Ad) do n ot show a distinct band, indicating weak e xpres sion of AFP mRNA. (B) Tissue specificity of AFP mRNA expression. Same probe as in (A). Total RNA was prepared from anterior (aF), central (cF) and posterior (pF) fat b ody, and haemocytes (H) of 7-day-old pupae . The 1.2-kb signal was detected in the anterior fat body and the haemocytes. A light signal only appears in the central fat body; no signal was obtained in the posterior fat body. Fig. 6. Immunostaining and in situ hybridization of Calliphora fat body. Longitudin al cryosections (10 lm) of 7-day-old larvae (A–C) were stained with a Cy2-conjugated goat anti-rabbit IgG after incubation with rabbit anti-AFP IgG. (A) In the border region of anterior (aF) and central fat body (cF), AFP-immunostaining appears only in the anterior fat body. (B) In a single fat body cell of the anterior fat body, AFP immunostaining is restricted to the cytoplasm. (C) AFP immunostaining can also be found in the cytoplasm of haemocytes. (D) In situ hybridization of longitudinal cryosections with a digoxygenin-labeled antisense AFP RNA probe shows no expression of AFP in muscle (m) and posterior fat body cells (pF). Haemocytes (hc) show high expre ssion of AFP m RNA. (E,F) Whole-mount in situ hybridization of upended 7-day-old larvae. The anterior fat body exhibits strong expression of AFP mRNA, whereas only weak expression is seen in the central fat body (cF) and no expression in the posterior fat body (pF) or the brain. The white bars in dicate 50 lm, and the black b ars indicate 250 lm. Ó FEBS 2002 Calliphora anterior fat body protein (Eur. J. Biochem. 269) 959 The possible function of AFP Nothing is known a bout the function of AFP to date. Its amino-acid sequence contains no conversant domains that suggest a function. In contrast with the mammalian liver protein, regucalcin, which is assumed to be derived from a common anc estral gene, AFP has been shown to have no calcium-binding activity in S. pe regrina [17] and is upregu- latedinadultD. melanogaster reared at low temperatures [22]. The i nteraction of AFP a nd the hexamerin receptor, shown in this paper, gives a first clue to a possible function of this protein. From our data, we conclude that it may b e involved in endocytosis of hexamerin by interacting with the receptor. As mentioned above, this molecular in teraction can only occur in the anterior fat body, a tissue known to contain fewer protein storage granules, particularly fewer hexamerin storage particles (R. Marx, personal communication), than the central and p osterior parts [16] and which rapidly disintegrates shortly after pupariation [17]. We speculate that, because of t he interaction with AFP, most o f the hexamerin receptor i s inactivated in the anterior fat body preventing uptake of storage protein in this part of the tissue. This study opens the wa y to further experiments in two distinct areas. On the one hand, the binding domains of AFP and the hexamerin receptor could be m apped in detail by functional dissection using truncated prey proteins in two-hybrid experiments. On the other hand, the use of antibodies against AFP in in vitro and in vivo experiments investigating hexamerin uptake by the anterior fat body may g ive insights i nto the nature of the i nteractions described above. Such approaches could l ead to a better understanding of the regulation of endocytotic uptake in the insect fat body and beyond. It is possible that hexamerin endocytosis in insects does not follow t he standard scheme of eukaryotic endocytosis. ACKNOWLEDGEMENTS This work was supported by a grant from the Deutsche Forsch ungs- gemeinschaft (Sche 195/13). W e are indeb ted to Dr Nakajima for the gift of antibodies against AFP. We thank Anneliese Striewe -Conz and Dieter Dudaczek for competent technical assistance. REFERENCES 1. Telfer, W.H. & Kunkel, J.G. (1991) The function and evolution of insect storage h examers. Annu. Rev. Entom ol. 36, 205–228. 2. Duhamel, R.C. & Kunkel, J.G. (1987) Moulting-cycle regulation of h aemolymph protein c learance in cockroache s: possible size- dependent mechanism. J. Insect Physiol. 33, 1 55–158. 3. Pan, M.I. & Telfer, W.H. (1992) Selectivity in storage hexamerin clearing demonstrated with hemolymph transfusions between Hyalophora cecropia an d Actias luna. Arch. Insect B iochem. Physiol. 19, 203–219. 4. Wang, Z. & Ha unerland, N. ( 1994a) Receptor-mediated endo- cytosis of storage proteins by the fat body of H elicoverpa zea. Cell Tissue Res. 278, 107–115. 5. Burmester, T. & Scheller, K. (1995) Ecdysterone-mediated uptake of arylphorin by larval fat bodies of Calliphora vicina: involvement and developmental regulation of arylphorin binding proteins. Insect Biochem. Mol. Biol. 25, 799–806. 6. Burmester, T. & Scheller, K. (1997) Conservation of hexamerin endocytosis in Diptera. Eur. J. Biochem. 244, 713–720. 7. Burmester, T. & Scheller, K. (1999) Ligands and receptors: com- mon theme in insect storage protein transport. Naturwissenschaften 86, 468–474. 8. Burmester, T. & Scheller, K. (1995) Complete cDNA-sequence of the recepto r responsible for arylphorin uptake by the larval fat body of the blowfly, Calliphora vicina. Insect Biochem. Mol. Biol. 25, 981–989. 9. Burmester, T. & Scheller, K. (1997) Developmentally controlled cleavage of the Calli phora arylphorin rece ptor and posttransla- tional regulation by 2 0-hydroxy-e cdysone . Eur. J. Biochem. 24 7, 695–702. 10. Locke, M. & Collins, J.V. (1965) The structure and formation of protein granules in the fat body of an insect. J. Cell Biol. 26, 857–884. 11. Locke, M. & Collins, J.V. (1968) Protein uptake in multivesicular bodies and sto rage g ranules in the fat body of an i nsect. J. Cell Biol. 36, 453–483. 12. Wang, Z. & Haunerland, N. (1994b) Storage protein uptake in Helicoverpa zea: arylphorin and VHDL share a single receptor. Arch. Insect. Biochem. Physiol. 26, 15–26. 13. Vanishree, V., Nirmala, X. & Krishnan, M. (1999) Differential synthesis of storage proteins by various fat body tissues during development of f emale silkworm, Bombyx mori. SAAS Bull.: Biochem. Biotechnol. 12, 69–89. 14. Ritzki, T.M. ( 1978) Fat body. In The Genetics and Biology of Drosophila (Ash burner, A. & Wright, T.R.F., e ds), Vol 2 b, pp. 561–601. Academic Press, New York. 15. Du ¨ bendorfer, A. & Eichenberger, S. (1985) In vitro metamorphosis of insect cells and t issues : devel opmen t and fun ction of fat b ody cells in embryonic cell cultures of Drosop hila. In Metamorphosis (Balls, M. & Bownes, M., eds), pp. 146–161. Oxford University Press, Oxford. 16. Butterworth, F.M. & Rasch, E.M. (1986) A d ipose tissue of Drosophila melanogaster. VII. Distribution of nuclear DNA amount along the an terior-posterior axis in the larval fat body. J. Exp. Zool. 239, 77–85. 17. Nakajima, Y. & Natori, S. (2000) Identification and character- ization of an anterior fat body protein in an insect. J. Biochem. 127, 901–908. 18. Scheller, K. & Karlson, P. (1977) Effects of ecdysteroids on RNA synthesis of fat body cells in Calliphora vicina. J. Insect Physiol. 23, 285–291. 19. Ausubel, F.M., Brent, R., Kingston, R.E ., Moo re, D.D ., Seid - man,J.G.,Smith,J.A.&Struhl,K.(1998)Current Protocols in Molecular Biology. John W iley & Sons, Ne wYork. 20. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd e dn. Cold Spring Harbor Laboratory Pr ess, Col d Spring Ha rbor , NY. 21. Harland, R.M. (1991 ) In situ hybridiz ation: an improved w hole - mount method for Xenopus embryos. Methods Cell Biol. 36, 685–695. 22. Goto, S.G. (2000) Expression of Drosophila homologue of s enes- cence marker protein-30 during cold acclimation. J. Insect Physiol. 46, 1111–1120. 960 I. A. Hansen et al.(Eur. J. Biochem. 269) Ó FEBS 2002 . Interaction of the anterior fat body protein with the hexamerin receptor in the blow y Calliphora vicina Immo A. Hansen, Susanne R. Meyer, Ingo Scha¨. fat body (cF), AFP-immunostaining appears only in the anterior fat body. (B) In a single fat body cell of the anterior fat body, AFP immunostaining is restricted