... MPH a Forward: 5Â-TAGAATTCGCTGCTCCACAA GTTAGAACT-3Â Reverse: 5Â-TA GCGGCCGCTTACTTTGGGTTA ACGACGGA-3Â Mutant MPH b G194P 5Â-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3Â G198P 5Â-AAAGGTTTCTTCAAG CCGGCCATGGCTTCCCTT-3Â G194P ... of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation Jian Tian, Ping Wang, Shan G...
Ngày tải lên: 15/02/2014, 01:20
... GCTTCTGGATCGTAGTTCAA CATTATTGGAATGAGGAAAT ATH1_G ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC ATH1_3633_BH GGATCCTCATTGAGAACAATTTCCTTGA ATH1_395_BH GGATCCATCATGTTCTCATCATCATAATATG ATH1_209_BH GGATCCGTTAAATATAATGCAGTGACGAAGATA ATH1_140_BH GGATCCAAGTCAAACCTTGAGAAAGAACGA mCherry–pSC1_D ... recombination region in italics. Name Oligo sequence F2_ATH1 ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGA...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf
... inhibition of cartilage and chondrocyte degeneration. Results Macroscopic and radiographic examination of the articular cartilage after experimentally induced OA Articular cartilage of the femoral condyles ... Journal 276 (2009) 73757385 ê 2009 The Authors Journal compilation ê 2009 FEBS Hypoxic resistance to articular chondrocyte apoptosis – a possible...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf
... probabilistically combine ParaMor (Monson, 2008) and Morfessor (Creutz, 2006). They used a natural language tagger which was trained on the output of ParaMor and Morfes- sor. The goal was to mimic each algorithm ... PROMODES-E directly accesses the probabilistic framework of each algorithm and combines them based on an optimal threshold learnt on a validation set. 5 Co...
Ngày tải lên: 20/02/2014, 04:20
Tài liệu Báo cáo khoa học: "Unlimited Vocabulary Grapheme to P h o n e m e Conversion for Korean TTS" pdf
... left and right con- nectivity information. The morpheme -to- phoneme conversion can gen- erate a lot of phoneme sequence candidates for single morpheme. We put the whole phoneme sequence candidates ... dictionary is developed to con- tain all the general patterns of Korean POS tags, morphemes, phoneme connectivity and phoneme sequences. Boundary phonemes of the OOV morphemes...
Ngày tải lên: 20/02/2014, 18:20
Báo cáo khoa học: UDP-galactose 4-epimerase from Kluyveromyces fragilis – catalytic sites of the homodimeric enzyme are functional and regulated docx
... that the catalytic sites of the enzyme are functional and are distinguishable on the basis of bind- ing with the inhibitor. Careful analysis of Fig. 2 shows that inactivation of E 3 by trypsin and ... Council of Scientic and Industrial Research, New Delhi. Journal compilation ê 2009 FEBS 6727 UDP-galactose 4-epimerase from Kluyveromyces fragilis...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: Insect cytokine, growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle pptx
... growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle Yosuke Ninomiya 1 and Yoichi Hayakawa 2 1 Graduate School of Environmental Earth Science, Hokkaido ... H, Tsuzuki S, Tanaka K, Matsumoto H, Hiruma K & Hayakawa Y (2003) Isolation and Regulation of melanin synthesis in insect cuticle Y. Ninomiya and Y....
Ngày tải lên: 16/03/2014, 11:20
Báo cáo khoa học: "Modeling Human Sentence Processing Data with a Statistical Parts-of-Speech Tagger" ppt
... Linguistics Modeling Human Sentence Processing Data with a Statistical Parts-of-Speech Tagger Jihyun Park Department of Linguisitcs The Ohio State University Columbus, OH, USA park@ling.ohio-state.edu Abstract It ... Sch ă utze. Foundations of Statistical Natural Language Processing. The MIT Press, Cambridge, Massachusetts, 1999. B. Roark. Probabilistic top-down parsing and...
Ngày tải lên: 17/03/2014, 04:20
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc
... that directly upstream of P HOP2 (5Â-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3Â and 5Â -ATCTTTCAAATAGAGCCTGG-3Â). The amplified DNA fragments were used to transform BFG2Z18-K3 5A, ... 5Â-AAATATAAAACGCTAGCGTCGACATGGC GC- 3Â and 5Â-AGCGTAAAGGATGGGGAAAG-3 Â. The nal ratio of target cells was determined by the number of colonies retaining the target gene d...
Ngày tải lên: 22/03/2014, 21:20
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt
... N-termini and within an adjacent 29 -amino-acid region referred to as the MEF2 domain. The MADS box is essential for DNA binding and dimerization, and the MEF2 domain plays an important role in DNA ... box-containing genes in various other organisms. Furthermore, the BmMEF2 gene is expressed in various tissues containing muscle and neural tissues in Bombyx as well as...
Ngày tải lên: 30/03/2014, 20:20
báo cáo khoa học: "How can we improve guideline use? A conceptual framework of implementability" pps
... 6:26 http://www.implementationscience.com/content/6/1/26 Page 4 of 11 RESEARCH Open Access How can we improve guideline use? A conceptual framework of implementability Anna R Gagliardi 1* , Melissa C Brouwers 2 , Valerie A Palda 3 , Louise ... Format elements that may facilitate guideline use are summarized in Table 5. One-half of the guidelines were published in jo...
Ngày tải lên: 10/08/2014, 10:23
Báo cáo y học: "The boy who refused an IV: a case report of subcutaneous clodronate for bone pain in a child with Ewing Sarcoma" pot
... headache, back pain and generalized arthralgia/myalgia. There was a particularly troubling bone pain involving his forearms, wrists and hands bilaterally. The arm pain was unpredict- able, episodic and intense ... 1 of 4 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report The boy who refused an IV: a case report...
Ngày tải lên: 11/08/2014, 10:22
báo cáo khoa học: " Enhanced relapse prevention for bipolar disorder: a qualitative investigation of value perceived for service users and care coordinators" pdf
... triggers and early warning signs had the potential to induce a relapse. Table 4: Value and clinical implications of ERP reported by care coordinators (CC) and service users (SU) Value Implications for ... that text me to say I am not sleeping, 'can I have some tablets'? I get it arranged, she comes and she picks it up, and that's that. She hasn'...
Ngày tải lên: 11/08/2014, 16:21
báo cáo khoa học: " Do patients think cannabis causes schizophrenia? A qualitative study on the causal beliefs of cannabis using patients with schizophrenia" pps
... RESEA R C H Open Access Do patients think cannabis causes schizophrenia? - A qualitative study on the causal beliefs of cannabis using patients with schizophrenia Anna Buadze 1 , Rudolf Stohler 1 , ... Do patients think cannabis causes schizophrenia? - A qualitative study on the causal beliefs of cannabis using patients wi...
Ngày tải lên: 11/08/2014, 18:20
báo cáo khoa học: " Exploring transcriptional signalling mediated by OsWRKY13, a potential regulator of multiple physiological processes in rice" pdf
... using primers WRKY12F (5'-GGGGACAAGTTTGTACAAAAAAGCAG- GCTGTGATGGCGGCAGGAGAG-3') contained attB1 site (in bold) and WRKY12R (5'-GGGGACCACTTTGTACAA- GAAAGCTGGGTTGAACACGACGGCGCACTC-3') ... for citation purposes) BMC Plant Biology Open Access Research article Exploring transcriptional signalling mediated by OsWRKY13, a potential regulator of multiple p...
Ngày tải lên: 12/08/2014, 03:20