báo cáo khoa học: " Enhanced relapse prevention for bipolar disorder: a qualitative investigation of value perceived for service users and care coordinators" pdf

... MPH a Forward: 5Â-TAGAATTCGCTGCTCCACAA GTTAGAACT-3Â Reverse: 5Â-TA GCGGCCGCTTACTTTGGGTTA ACGACGGA-3Â Mutant MPH b G194P 5Â-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3Â G198P 5Â-AAAGGTTTCTTCAAG CCGGCCATGGCTTCCCTT-3Â G194P ... of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation Jian Tian, Ping Wang, Shan G...

Ngày tải lên: 15/02/2014, 01:20

... GCTTCTGGATCGTAGTTCAA CATTATTGGAATGAGGAAAT ATH1_G ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC ATH1_3633_BH GGATCCTCATTGAGAACAATTTCCTTGA ATH1_395_BH GGATCCATCATGTTCTCATCATCATAATATG ATH1_209_BH GGATCCGTTAAATATAATGCAGTGACGAAGATA ATH1_140_BH GGATCCAAGTCAAACCTTGAGAAAGAACGA mCherry–pSC1_D ... recombination region in italics. Name Oligo sequence F2_ATH1 ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGA...

Ngày tải lên: 18/02/2014, 06:20

... inhibition of cartilage and chondrocyte degeneration. Results Macroscopic and radiographic examination of the articular cartilage after experimentally induced OA Articular cartilage of the femoral condyles ... Journal 276 (2009) 73757385 ê 2009 The Authors Journal compilation ê 2009 FEBS Hypoxic resistance to articular chondrocyte apoptosis – a possible...

Ngày tải lên: 18/02/2014, 14:20

... probabilistically combine ParaMor (Monson, 2008) and Morfessor (Creutz, 2006). They used a natural language tagger which was trained on the output of ParaMor and Morfes- sor. The goal was to mimic each algorithm ... PROMODES-E directly accesses the probabilistic framework of each algorithm and combines them based on an optimal threshold learnt on a validation set. 5 Co...

Ngày tải lên: 20/02/2014, 04:20

... left and right con- nectivity information. The morpheme -to- phoneme conversion can gen- erate a lot of phoneme sequence candidates for single morpheme. We put the whole phoneme sequence candidates ... dictionary is developed to con- tain all the general patterns of Korean POS tags, morphemes, phoneme connectivity and phoneme sequences. Boundary phonemes of the OOV morphemes...

Ngày tải lên: 20/02/2014, 18:20

... that the catalytic sites of the enzyme are functional and are distinguishable on the basis of bind- ing with the inhibitor. Careful analysis of Fig. 2 shows that inactivation of E 3 by trypsin and ... Council of Scientic and Industrial Research, New Delhi. Journal compilation ê 2009 FEBS 6727 UDP-galactose 4-epimerase from Kluyveromyces fragilis...

Ngày tải lên: 16/03/2014, 00:20

... growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle Yosuke Ninomiya 1 and Yoichi Hayakawa 2 1 Graduate School of Environmental Earth Science, Hokkaido ... H, Tsuzuki S, Tanaka K, Matsumoto H, Hiruma K & Hayakawa Y (2003) Isolation and Regulation of melanin synthesis in insect cuticle Y. Ninomiya and Y....

Ngày tải lên: 16/03/2014, 11:20

... Linguistics Modeling Human Sentence Processing Data with a Statistical Parts-of-Speech Tagger Jihyun Park Department of Linguisitcs The Ohio State University Columbus, OH, USA park@ling.ohio-state.edu Abstract It ... Sch ă utze. Foundations of Statistical Natural Language Processing. The MIT Press, Cambridge, Massachusetts, 1999. B. Roark. Probabilistic top-down parsing and...

Ngày tải lên: 17/03/2014, 04:20

... that directly upstream of P HOP2 (5Â-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3Â and 5Â -ATCTTTCAAATAGAGCCTGG-3Â). The amplified DNA fragments were used to transform BFG2Z18-K3 5A, ... 5Â-AAATATAAAACGCTAGCGTCGACATGGC GC- 3Â and 5Â-AGCGTAAAGGATGGGGAAAG-3 Â. The nal ratio of target cells was determined by the number of colonies retaining the target gene d...

Ngày tải lên: 22/03/2014, 21:20

... N-termini and within an adjacent 29 -amino-acid region referred to as the MEF2 domain. The MADS box is essential for DNA binding and dimerization, and the MEF2 domain plays an important role in DNA ... box-containing genes in various other organisms. Furthermore, the BmMEF2 gene is expressed in various tissues containing muscle and neural tissues in Bombyx as well as...

Ngày tải lên: 30/03/2014, 20:20

... 6:26 http://www.implementationscience.com/content/6/1/26 Page 4 of 11 RESEARCH Open Access How can we improve guideline use? A conceptual framework of implementability Anna R Gagliardi 1* , Melissa C Brouwers 2 , Valerie A Palda 3 , Louise ... Format elements that may facilitate guideline use are summarized in Table 5. One-half of the guidelines were published in jo...

Ngày tải lên: 10/08/2014, 10:23

... headache, back pain and generalized arthralgia/myalgia. There was a particularly troubling bone pain involving his forearms, wrists and hands bilaterally. The arm pain was unpredict- able, episodic and intense ... 1 of 4 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report The boy who refused an IV: a case report...

Ngày tải lên: 11/08/2014, 10:22

... triggers and early warning signs had the potential to induce a relapse. Table 4: Value and clinical implications of ERP reported by care coordinators (CC) and service users (SU) Value Implications for ... that text me to say I am not sleeping, 'can I have some tablets'? I get it arranged, she comes and she picks it up, and that's that. She hasn'...

Ngày tải lên: 11/08/2014, 16:21

... RESEA R C H Open Access Do patients think cannabis causes schizophrenia? - A qualitative study on the causal beliefs of cannabis using patients with schizophrenia Anna Buadze 1 , Rudolf Stohler 1 , ... Do patients think cannabis causes schizophrenia? - A qualitative study on the causal beliefs of cannabis using patients wi...

Ngày tải lên: 11/08/2014, 18:20

... using primers WRKY12F (5'-GGGGACAAGTTTGTACAAAAAAGCAG- GCTGTGATGGCGGCAGGAGAG-3') contained attB1 site (in bold) and WRKY12R (5'-GGGGACCACTTTGTACAA- GAAAGCTGGGTTGAACACGACGGCGCACTC-3') ... for citation purposes) BMC Plant Biology Open Access Research article Exploring transcriptional signalling mediated by OsWRKY13, a potential regulator of multiple p...

Ngày tải lên: 12/08/2014, 03:20