0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " The intellectual structure and substance of the knowledge utilization field: A longitudinal author co-citation analysis, 1945 to 2004" potx

Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

... the human C-domain in solution, and present dataon its dynamics. On the basis of the structural data,we have performed a mutational analysis of the C-domain and investigated the impact of the ... signal of the preceding amino acid, correlating the amide HN and the Ca signals, correlating the amide HN and the Ca signal of the preceding amino acid, correlating the amide NH with the Ca and Cb ... retains its RFactivity [15]. The combination of the humanM-domain and C-domain, in the absence of the N-domain, is able to bind to the mammalian ribosome and to induce the GTPase activity of eRF3...
  • 17
  • 490
  • 0
báo cáo khoa học:

báo cáo khoa học: " The intellectual structure and substance of the knowledge utilization field: A longitudinal author co-citation analysis, 1945 to 2004" potx

... from aggregate author co-citation data, link oeuvres and offer a panorama of the changing intellectual structure of the field, showing the "history of the consensus as to important authors ... find a 'fading' of the diffusionparadigm. Our citation maps show that there is not a shiftaway from the diffusion paradigm; rather, there is a spread of the paradigm to other fields and ... dec-ade in the domain of diffusion of innovations. AlthoughWhite and McCain argue that the reappearance of olderwork may indicate the revival of a domain [49], weattribute the reappearance of...
  • 22
  • 316
  • 0
Báo cáo khoa học: High resolution structure and catalysis of O-acetylserine sulfhydrylase isozyme B from Escherichia coli pot

Báo cáo khoa học: High resolution structure and catalysis of O-acetylserine sulfhydrylase isozyme B from Escherichia coli pot

... sub-units C and D of the other dimer. As the three muta-tions of CysM(RKE) are all at the surface distantfrom the active center, they are unlikely to affect the internal stability of the protein. ... 132, 202 and 215 form the lips of the mouth of the active center pocket(Fig. 1) and are therefore important for catalysis. The other peaks correspond to loops at the surface that areusually mobile ... random crystal contacts, they still outline the available conformational space and, most probably, the induced fit motions during the reaction. The conformational changes are also reflected in the B-factor...
  • 8
  • 382
  • 0
Báo cáo khóa học: Metal-binding stoichiometry and selectivity of the copper chaperone CopZ from Enterococcus hirae pot

Báo cáo khóa học: Metal-binding stoichiometry and selectivity of the copper chaperone CopZ from Enterococcus hirae pot

... (5¢-GGGCCGGCGGCCATGGCTAAACAGGAATTCTCGGTTAAAGGTATGTCTTGCAAC-3¢); copz-ap2, (5¢-GATACGACCAACAGCTTCTTCGATACGAGCAACGCAGTGGTTGCAAGACATACCTTTAAC-3¢); copz-p3, (5¢-GAAGCTGTTGGTCGTATCTCTGGTGTTAAAAAAGTTAAAGTTCAGCTGAAGAAAGAAAAG-3¢); ... (5¢-GAAGCTGTTGGTCGTATCTCTGGTGTTAAAAAAGTTAAAGTTCAGCTGAAGAAAGAAAAG-3¢); copz-ap4,(5¢-GGTAGCCTGAACGTTAGCTTCGTCGAATTTAACAACAGCCTTTTCTTTCTTCAGCTGAAC-3¢); copz-p5, (5¢-GAAGCTAACGTTCAGGCTACCGAAATCTGCCAGGCTATCAACGAACTGGGTTACCAGGCT-3¢);copz-ap6, ... quantitative determination of nanogram amounts of total and oxidized glutathione: appli-cations to mammalian blood and other tissues. Anal. Biochem. 27,502–522.34. Corazza, A. , Harvey, I. &...
  • 11
  • 307
  • 0
Báo cáo khoa học: Coexpression, purification and characterization of the E and S subunits of coenzyme B12 and B6 dependent Clostridium sticklandii D-ornithine aminomutase in Escherichia coli potx

Báo cáo khoa học: Coexpression, purification and characterization of the E and S subunits of coenzyme B12 and B6 dependent Clostridium sticklandii D-ornithine aminomutase in Escherichia coli potx

... primer names and seq uences.Primername Sequence21 GGGTCTAGAATGGAAAAAGATCTACAGTTAAGA33 CCGGAATTCTTATTTCCCTTCTCTCATCTC40 GCGCGCCATGGAAAAAGATCTACAGTTAAGA41 GGGGGATCCCCATAATCCACTCCACCTGCTAAA44 ... GGGGGATCCCCATAATCCACTCCACCTGCTAAA44 GGGGGGGATCCT CATTATTTCCCTTCT66 AATACCGCCATGTATAATATCTATTACTTC67 GTAATAGATATTATACATGGCGGTATTGAA75 GGGGGGGCCATGGAAAGAGCAGACGATTT4294 H P. Chen et al.(Eur. J. Biochem. 271) ... pyridoxal 5 ¢-phosphate via an azomethine linkbetween the formyl group of the c ofactor and the aminogroup of a protein residue. In contrast, the absence of absorption maximum at 420 nm of the...
  • 5
  • 401
  • 0
Báo cáo khoa học: Expression, purification and characterization of the second Kunitz-type protease inhibitor domain of the human WFIKKN protein pot

Báo cáo khoa học: Expression, purification and characterization of the second Kunitz-type protease inhibitor domain of the human WFIKKN protein pot

... plasma kallikrein and porcine pancreatic kallikrein (Calbiochem, Affiliate of Merck, Darmstadt) were commercial preparations. The synthetic substrates N-succinyl-Ala-Ala-Pro-Phe-pNA and N -a- benzoyl-L-Arg-pNA ... N -a- benzoyl-L-Arg-pNA (L-BAPNA) werepurchased from Sigma,D-Val-Leu-Lys-pNA and D-Pro-Phe-Arg-pNA were from Serva. Glu-Gly-Arg-pNA,D-Ile-Pro-Arg-pNA, Bz-Phe-Val-Arg-pNA,D-Val-Leu-Arg-pNA and succinyl-Ala-Ala-Ala-pNA ... view of the fact that the structure of the Kunitz inhibitor of the seaanemone Stichodactyla helianthus is nearly identical withthat of the bovine pancreatic trypsin inhibitor despite a mere35%...
  • 7
  • 292
  • 0
báo cáo khoa học:

báo cáo khoa học: " Genome-wide identification and analyses of the rice calmodulin and related potential calcium sensor proteins" pdf

... 5'-ACACAATCTCCTCTGCCTTA-3'OsCaM1-3F 5'-CCCCTCGCCGCCTCGCCACC-3'OsCaM1-3R 5'-CCCATAACCAAATGCTGTCA-3'OsCaM2-F 5'-GAGGAGGGTTCCCATTAAAT-3'OsCaM2-R 5'-CGCAAGCTAAGCATCACAAT-3'OsCaM3-F 5'-CCTTCCTCTCTCTCTCGCTC-3'OsCaM3-R ... SequenceOsCaM1-1F 5'-GAAGCCAGGCTAAGCCCAGC-3'OsCaM1-1R 5'-GCAAGCCTTAACAGATTCAC-3'OsCaM1-2F 5'-CTTCGTTGATCCACTCACCC-3'OsCaM1-2R 5'-ACACAATCTCCTCTGCCTTA-3'OsCaM1-3F ... usedin the alignment are as follows: ACaM2 [GenBank:AAA32763]; HvCaM [GenBank: AAA32938]; T-CaM1[GenBank: AAC49578]; ZmCaM [GenBank: CAA52602];SCaM1 [GenBank: AAA34013]; PCM5 [GenBank:AAA85155];...
  • 17
  • 277
  • 0
The intellectual structure and substance of the knowledge utilization field: A longitudinal author co-citation analysis, 1945 to 2004 pdf

The intellectual structure and substance of the knowledge utilization field: A longitudinal author co-citation analysis, 1945 to 2004 pdf

... interpretations of citationpatterns are valid. Author co-citation analysisIn ACA, cited and co-cited authors are the unit of analysis[51]. As White and Griffith point out, " ;Co-citation of authors ... dec-ade in the domain of diffusion of innovations. AlthoughWhite and McCain argue that the reappearance of olderwork may indicate the revival of a domain [49], weattribute the reappearance of ... by aggregating the data. For co-citation analysis, selection of authors was by frequency of citation. Selection of authors for co-citation analysiscan be by a variety of means, such as personal...
  • 22
  • 393
  • 0
Báo cáo khoa học: Identification, structure and differential expression of novel pleurocidins clustered on the genome of the winter flounder, Pseudopleuronectes americanus (Walbaum) ppt

Báo cáo khoa học: Identification, structure and differential expression of novel pleurocidins clustered on the genome of the winter flounder, Pseudopleuronectes americanus (Walbaum) ppt

... susan.douglas@nrc.caAbbreviations: AP-1, activator protein 1; ATF, activating transcriptionfactor-1; CAAT, CCAAT binding factor; C/EBP, CAAT/enhancerbinding protein; d.p.h., days posthatch; GATA, GATA ... anti-microbial activity. These data can be used as a basis forprediction of antimicrobial peptide candidates for bothhuman and nonhuman therapeutants from genomicsequences and will aid in understanding ... been isolated from a widevariety of plants, animals, fungi and bacteria, and play animportant role in defense against microbial infection. Many of these small molecules are amphiphilic a- helices...
  • 11
  • 415
  • 0
Tài liệu Báo cáo khoa học: Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity pptx

Tài liệu Báo cáo khoa học: Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity pptx

... behavior and body weight. ACC, acetyl-CoA car-boxylase; AMPK, 5¢ AMP kinase; CPT, carnitine palmitoyltransfer-ase; FAS, fatty acid synthase; MCD, malonyl-CoA decarboxylase;OAA, oxaloacetate; ... poten-tially a therapeutic avenue to treat obese and diabeticpeople. Manipulating metabolic pathways for the treat-ment of disease has once again placed basic metabo-lism research at the forefront of ... acids. The initial and committed step of de novofatty acid synthesis is the carboxylation of acetyl-CoA to form malonyl-CoA, catalyzed by ACC – the key reg-ulatory enzyme in the pathway. Malonyl-CoA...
  • 7
  • 678
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015