báo cáo khoa học: " Synthetic lethality: a framework for the development of wiser cancer therapeutics" docx

... loss of alternative, collateral DNA repair pathways, such as the base-excision repair pathway. Proteins encoded by the breast cancer genes BRCA1 and BRCA2 have important roles in the repair of ... that are synthetically lethal. Lower case, mutant; upper case, wild-type. (b) The effect of mutations and inhibitors on a pair of synthetically lethal genes, A and B. A...

Ngày tải lên: 11/08/2014, 12:20

... dirty-window-effect. For the perceptual evaluation of each artifact, a particular instantiation of the generalized framework, was presented and the associated results were EURASIP Journal on Image and Video ... Evaluation. The development of frame- work for halftone flicker evaluation will parallel the approach, utilized above, for the evaluation of DWE, since flic...

Ngày tải lên: 21/06/2014, 08:20

... having eaten anything. They take laxatives, antac- ids and other medications to get relief for their gastroin- testinal disturbances, they complain of losing their taste sensation, they lack appetite, ... of Granma, Cuba Email: Sergio A Pérez Barrero - serper.grm@infomed.sld.cu Abstract The family can play an important role in the prevention of suicide if it is capable of aidi...

Ngày tải lên: 08/08/2014, 23:20

... hemobilia with selective hepatic artery embolization. J Vasc Intervent Radiol 1995, 6(5):793-798. 10. Yamakado K, Nakatsuka A, Tanaka N, Takano K, Matsumura K, Takeda K: Transcatheter arterial embolization ... Selective arter- iography may also sho w active bleeding and anatomic variations such as an anomalous or replaced hepatic artery [6], and can be used in simultaneous diagnosis and trea...

Ngày tải lên: 10/08/2014, 23:20

... (interpreted as the amount of variance accounted for by each factor) was constructed. The point at which the slope of the plot changes from a rapid to a slow decline is the cut-off for the number of factors ... completed the statistical anal- ysis, and wrote the manuscript draft. All authors read and approved the final manuscript. Acknowledgements We wish to pa...

Ngày tải lên: 11/08/2014, 18:20

... ctctgcccactaagggt aaatttcatttaataatgtaatggagatcg 204 IX ccttttgtgaccatttactaaggata accagaaacaggtgaaataact 157 X acaatacttagaggatgcatctga ggtgaagaggcgcataca 212 XI ggtatttctgacttgtatgaccatt accagataaacagtaaagcagc ... gggtatacctcggtggattc agactagtggaggcgttt 167 V gaaggtatcgtctaattgcatatct caataaattggaaggtgtctcgtt 154 SBEIIa-D IX accatttactaaggatatttacatgcaa accagaaacaggtgaaataact 151 X acaatact...

Ngày tải lên: 11/08/2014, 11:21

... is formed only in the region of endothelial damage, so that a local hemostasis occurs via the subsequent activation of fac- tors IX and X and the formation of thrombin. After that, thrombin activates ... 1 Flowchart on the analyses of case seriesFlowchart on the analyses of case series. rFVIIa, recombinant activated factor VII. Available online http://ccforum.com/content...

Ngày tải lên: 13/08/2014, 10:20

... reported that multiple mutations can cause large changes in the average conformation of denatured proteins. Here we show that a specific single mutation or removal of a specific fragment can cause large ... Institute of BioAgricultural Sciences, Academia Sinica, Taipei, Taiwan, ROC 2 Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC 3 Department of Biochemistry, Univers...

Ngày tải lên: 20/02/2014, 01:20

... Koshiyama A, Hamada FN, Namekawa SH, Iwabata K, Sugawara H, Sakamoto A, Ishizaki T & Sakaguchi K (2006) Sumoylation of a meiosis-specific RecA homo- log, Lim15/Dmc1, via interaction with the small ... Iwabata K, Koshiyama A, Yamaguchi T, Sugawara H, Hamada FN, Namekawa SH, Ishii S, Ishizaki T, Chiku H, Nara T et al. (2005) DNA topoisomerase II interacts with Lim15/Dmc1 in meiosis....

Ngày tải lên: 07/03/2014, 05:20

... 5¢-GGGACTATGAT GATGGGTTTGTGAGGAAATGT-3¢ and 5¢-ACATTTC CTCACAAACCCATCATAGTCCC-3¢. HEL cell nuclear proteins carried by the probes were separated using strept- avidin-magnetic beads (Qiagen, Valencia, ... 5¢-AATGTTCATGGGGCGGC CATC-3¢, for RH: sense, 5¢-GCAACGATACCCAGTTT GTC-3¢ and antisense, 5¢-AGTTGACACTTGGCCAGA AC-3¢. The relative amounts of Aly ⁄ REF and RH were assessed as differen...

Ngày tải lên: 16/03/2014, 19:20