báo cáo khoa học: "Nodulin 41, a novel late nodulin of common bean with peptidase activity" pot
báo cáo khoa học: "Nodulin 41, a novel late nodulin of common bean with peptidase activity" pot
... 413 ttgattttcaagtggagtatgatctcgaagggaagaaagtttcttttcaacctactgattgctctaaagtttaaa 1350 I D F Q V E Y D L E G K K V S F Q P T D C S K V * 437 ataatatatatatatatatataataataataataataataataatatgatatatatgtatgtgtaaaataaagaa ... 263 tcgggaacgaatcaataataacgggagaaggtgttgtatccactccgatgataatcaaaccgtggttaccgacct 900 F G N E S I I T G E G V V S T P M I I K P W L P T 288 attactttctgaaccttgaagccgtcaccgttgcacaa...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx
... CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA 364AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 4 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG 5 1028 A. Ray et al. ... variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation Alpana Ray 1 , Srijita Dhar 1 , Arvind Shakya 1 , Papiya Ray 1 , Yasunori Okada 2 and Bimal K. Ray 1 1 Department of Vete...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 was constructed ... primers disSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA CATGCATGAAACCTACAGCTGAAGCTTCGT...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: BGN16.3, a novel acidic b-1,6-glucanase from mycoparasitic fungus Trichoderma harzianum CECT 2413 ppt
... Trichoderma harzianum. Mol Gen Genet 247, 639–645. 19 Oyama S, Yamagata Y, Abe K & Nakajima T (2002) Cloning and expression of an endo-1,6-beta-d-glucanase gene (neg1) from Neurospora crassa. Biosci ... Plant Dis 87, 4–10. 4 Hermosa MR, Grondona I, Iturriaga EA, Diaz-Minguez JM, Castro C, Monte E & Garcia-Acha I (2000) Mole- cular characterization and identification of biocontrol i...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc
... (5¢-GAATTCatgaaggttctcctccactg-3¢) and rO-MACS-XhoI-D (5¢-CTCGAGtgcccgtccccactcctggt-3¢) for o-macs; EcoRI-mMACS1-U (5¢-GAATTCatgcagtggc tgaagagttt-3¢) and mMACS1-XbaI-D (5¢-TCTAGAtagct gaccaaactccttg-3¢)forMACS1, ... 5¢-ccttctggggcactgagatg-3¢ (forward), 5¢-agaac gcatgcagccgaggg-3¢ (reverse); KS2 5¢-tggtagctacctggga agcc-3¢ (forward), 5¢-gaagcaccagactcattctg-3¢ (reverse); MACS1 5¢-gagttggagc...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt
... crucial to stabilize the organiza- tion of transvacuolar strands and maintain overall cellular architecture. As mentioned above, CRP1 may participate in the formation and ⁄ or maintenance of long ... were visualized using transmission electron microscopy (Hitachi Ltd., Saitama, Japan) at an accelerating voltage of 80 kV and a nominal magnification of ·100 000 [18]. Measurement of c...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc
... the septal nacreous layer of Nautilus macromphalus L. (Mollusca, Cephalopoda). Zoology 109, 85–95. 33 Zhao H, Samata T, Takakura D, Hashimoto R, Miyazaki Y, Nozawa T & Hikita Y (2003) Organic matrix ... Nagakura T, Ohkubo T, Sakagu- chi K, Tanaka M, Nakashima K & Takahashi T (1997) Structure of mollusc shell framework proteins. Nature 387, 563–564. 3 Suzuki M, Saruwatari K, Kogure...
Ngày tải lên: 22/03/2014, 16:20
Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx
... gagt … ccac ag GGATGT 1.4 3 105 a TAACAG gt aata … ttcc ag ACGTAT 6.5 4 250 TATCTG gt atgt … taac ag GATATG 0.89 5 120 ACGGAG gt aaaa … tccc ag CAACTC 1.7 6 138 GTTTTG gt aaga … attt ag GGCAGT 0.52 7 117 ... 7.7 4 262 a TACTTG gt atgt … aatc ag GATATG 1.3 5 120 a ACAGAG gt aaaa … tctc ag AAAATT 9.9 6 138 GCATTG gt aagg … attt ag GGCAGT 1.2 7 117 CATTAT gt aagt … tttc ag GATATT 0.17 8 16...
Ngày tải lên: 23/03/2014, 13:20
báo cáo khoa học: " Percussion hemoglobinuria - a novel term for hand trauma-induced mechanical hemolysis: a case report" doc
... Vasudev 2 , Barbara A Bresnahan 1 , Eric P Cohen 1 , Parameswaran N Hari 3 , Sundaram Hariharan 1 and Brahm S Vasudev 1* Abstract Introduction: Extracorpuscular hemolysis caused by mechanical trauma has ... both genders and after a wide range of activities. It has been associated with walking, running and marching [2], and also with Japanese fencing and karate [3]. A few authors h...
Ngày tải lên: 10/08/2014, 23:20
Báo cáo khoa học: " Evidence for a novel gene associated with human influenza A viruses" pptx
... influenza A virus genomes was complicated by a variety of errors in the available data sets. There are a number of minor and major (those that break essential genes) sequencing errors including contamination ... for 1) translation of genomic RNAs or 2) generation of mRNAs with the same sequence as genome strands has been proposed for influenza A virus. A thorough survey an...
Ngày tải lên: 12/08/2014, 04:20