báo cáo khoa học: " Tic20 forms a channel independent of Tic110 in chloroplasts" pot
báo cáo khoa học: " Tic20 forms a channel independent of Tic110 in chloroplasts" pot
... CTCCTTTGATGTCCTCTACCPs18SrRNA CCAGGTCCAGACATAGTAAG GAGGGTTACCTCCACATAGAtTic20-I AGGTTATAGGGACCGTTAGC CTTAGTCGTACGGAATCTGGAtTic20-IV CTATGTCCAACCTTTTCTCG CTGTTTCAAGAAGCATACCCAtTic110 CTAAAGGAGTGGTCTTGTCG ... GCAGAAGATAATGCTCCATCAt18SrRNA AACTCGACGGATCGCATGG ACTACCTCCCCGTGTCAGGGene-specific primers generated for PsTic20, PsTic110, Ps18SrRNA, AtTic20-I,AtTic20-IV, AtTic110 and At18SrRNA applied in ... symbolise a- helical transmembrane domains (TM 1-4). IMS - intermembrane space.(C) The mature parts of Tic20 from Pisum sativum (PsTic20, amino acids 83-253) and Arabidopsis thaliana (AtTic20 amino acids...
- 16
- 213
- 0
Báo cáo khoa học: The natural mutation by deletion of Lys9 in the thrombin A-chain affects the pKa value of catalytic residues, the overall enzyme’s stability and conformational transitions linked to Na+ binding pdf
... than in the WT form(33 min).Characterization of stabilizing interactionsbetween A- and B-chains In WT thrombin, the A- chain assumes an overallboomerang-like shape interacting with the B-chain ... experimentally. In analogy with the values calculated in enzymaticexperiments, an increase of % 0.5 pK units of theHis57 in DK9 mutant was also calculated analyzing theNAPAP data set (Table 1C). In ... thrombin was character-ized by a saturable increase in fluorescence at 342 nm(Fig. 2). The apparent equilibrium dissociation con-stant of Na+binding was calculated using a singlesite binding...
- 11
- 553
- 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx
... Slc1 2a2 mRNA were designed asfollows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAATCACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACATCCTTGGTACCAGGTGATTTTTCTTGTGAAGAT.All experimental protocols described in ... site.Proc Natl Acad Sci USA 95, 14220–14225.18 Ohto H, Kamada S, Tago K, Tominaga S, Ozaki H,Sato S & Kawakami K (1999) Cooperation of Six andEya in activation of their target genes through ... 110, 151–164.26 Tomari S, Nagahama H, Shu Y, Hoshi S, NakayamaK, Nakayama KI & Nagata M (2002) Glomerular dif-ferentiation in p27 and p57 double-mutant metanephroi.Anat Embryol 206, 31–36.27...
- 16
- 476
- 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc
... (5¢-GAATTCatgaaggttctcctccactg-3¢)and rO-MACS-XhoI-D (5¢-CTCGAGtgcccgtccccactcctggt-3¢)for o-macs; EcoRI-mMACS1-U (5¢-GAATTCatgcagtggctgaagagttt-3¢) and mMACS1-XbaI-D (5¢-TCTAGAtagctgaccaaactccttg-3¢)forMACS1, ... S Rat RYA3 potential ligand binding protein ND BGRat cocaine, amphetamine-regulated transcript 1>2 N Rat RYD5 potential ligand binding protein ND BGRat protocadherin-7c 1>2>3 N* Rat ... Fujino, T., Takei, Y .A. , Sone, H., Ioka, R.X., Kamataki, A. ,Magoori, K., Takahashi, S., Sakai, J. & Yamamoto, T.T. (2001)Molecular identification and characterization of two medium-chain acyl-CoA...
- 10
- 393
- 0
Báo cáo khoa học: "PREDICTIVE COMBINATORS A METHOD PROCESSING OF COMBINATORY CATEGORIAL GRAMMARS" doc
... combinators, that replace the basic forms of functional composition and type raising in the original grammar. After first reviewing the theory of Combinatory Categorial Grammar and the attendant ... Categorial Unification Grammars. In Proceedings of Coling 1986, pp. 187-194. Wittenburg, K. 198 5a. Natural Language Parsing with Combinatory Categorial Grammars in a Graph- Unification-Based ... Department of Linguistics University of Texas at Austin Austin, TX 78712 ABSTRACT Steedman (1985, 1987) and others have proposed that Categorial Grammar, a theory of syntax in which grammati- cal...
- 8
- 354
- 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... ATTTCAGCAGCATACTCCACAATAAAAAGPPP6C-siR-Top GATCCGCTTTGTGTAAGTAATTTGATTCAAGAATCAAATTACTTACAAGTTTTTTGAATTCTCGAGAPPP6C-siR-Bottom AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATTTGATCTCTTGAACAAATTACTTACACAAAGAGPPP6C-forward ... MicroRNA-373, a new regulator of protein phosphatase 6,functions as an oncogene in hepatocellular carcinomaNannan Wu*, Xuyuan Liu*, Xuemei Xu*, Xingxing Fan, Min Liu, Xin Li, Qiping Zhong andHua ... PPP6C antisense as above; b-actin sense, 5¢-CGTGAC-ATTAAGGAGAAGCTG-3¢; and b-actin antisense, 5¢-CT-AGAAGCATTTGCGGTGGAC-3¢. PCR cycles were asfollows: 94 °C for 5 min, followed by 40 cycles at...
- 11
- 396
- 0
Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx
... rather than adsorption on the enzymaticrate. Thus, the cellulase activity and initial rate data obtained from varioussamples may provide valuable information about the details of the mecha-nistic ... of untreated Avicel.Multivariate statistical analysis of X-ray dataThe CrI of cellulose samples was also calculated by quanti-fying the contribution of amorphous cellulose (PASC) andAvicel ... crystallinity and the change of the degree of crystallinity during enzymatic hydrolysis. It isaccepted that the initial degree of crystallinity of cellu-lose plays a major role as a rate determinant...
- 12
- 554
- 0
Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx
... 2. Mutant forms of CTNS fail to complement ers1D. (A) Schematic diagram of the predicted topology of cystinosin. Magenta and bluedots represent those amino acids that are invariant in an alignment ... com-parative purposes, we also assayed LysoSensor greenstaining of a vma1D strain, which lacks the 118-kDasubunit of the V-ATPase (Fig. 5A) and is defective in vacuolar acidification. Compared ... strain(data not shown) or to the isogenic parental wild typestrain, in the meh1D strain LysoSensor staining wasdiminished (Fig. 5A) although it was not absent, as itwas in the vma1D strain....
- 15
- 378
- 0
Báo cáo khoa học: "Comparing Objective and Subjective Measures of Usability in a Human-Robot Dialogue System" potx
... consists of a pair of manipulator arms with grippers, mounted in a position to resemble human arms, and an an-imatronic talking head (van Breemen, 2005) ca-pable of producing facial expressions, ... Proceedings of CHI 1998. doi:10.1145/274644.274722.M. A. Walker, D. J. Litman, C. A. Kamm, and A. Abella. 1997. PARADISE: A framework forevaluating spoken dialogue agents. In Proceed-ings of ACL/EACL ... Natural Language Engineer-ing, 6(3–4):363–377.M. A. Walker. 2000. An application of reinforce-ment learning to dialogue strategy selection in a spoken dialogue system for email. Journal of Artificial...
- 9
- 310
- 0
Báo cáo khoa học: "Metaphor Comprehension - A special mode of language pptx
... the larger and richer knowledge domains which have to be handled. The main conclusion of the paper is that the notions of processing capacity, memory constraints and control structure are ... theories of metaphor within linguistics and psychology. 4. CONCLUSIONS The final part of the paper examines the relationship between metaphor comprehension and existing language comprehension ... context information which was missing in the original input. The goal of the context construction procedure is to provide a context information in which the GCS-TKS connections are fully interpreted,...
- 2
- 311
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ