báo cáo khoa học: "Fatty acid profiles and their distribution patterns in microalgae: a comprehensive analysis of more than 2000 strains from the SAG culture collection" docx
... this article as: Lang et al.: Fatty acid profiles and their distribution patterns in microalgae: a comprehensive analysis of more than 2000 strains from the SAG culture collection. BMC Plant Biology ... third of the strains exhibited more than 5% ARA with extraordinarily high values of 41.3% and 34.3% in Rhabdo monas incurva SAG 1271-8...
Ngày tải lên: 11/08/2014, 11:21
... to each serotype of the virus (present in all strains of the serotype), and (d) unique to each individual viral strain’s genome (present in the strain and absent from all other strains) . The ... encephalitis, and dengue fever. One or more of the four serotypes of the dengue virus are endemic in many parts of the world, including all of south-east...
Ngày tải lên: 23/03/2014, 11:20
... analysis. Conclusion: The polymerase genes of HIV-1 strains from Ghana are made up of recombinants of several CRF 02_AG strains from Ghana, Senegal and Cameroon, but the clinical implications are unknown. Using the ... analysis. Thus, the polymerase genes of HIV-1 strains from Ghana are made up of recombinants of several CRF 02_AG strains from Ghana,...
Ngày tải lên: 12/08/2014, 04:21
báo cáo khoa học: "Harmonic scalpel versus flexible CO2 laser for tongue resection: A histopathological analysis of thermal damage in human cadavers" potx
... 13.0 was maintained for the data entry and statistical analysis. Thermal depth between harmonic scalpel and CO2 laser was compared using Independent sample T-test. A p-value less than 0.05 was considered ... effective and p recise cutting tool in the head and neck region [3-6]. Each modality has their advantages and disadvantages. T he applicability of the laser par...
Ngày tải lên: 09/08/2014, 02:20
Tài liệu Báo cáo khoa học: Fatty acid synthesis Role of active site histidines and lysine in Cys-His-His-type b-ketoacyl-acyl carrier protein synthases ppt
... vicinity of the active site (Fig. 2). Three of the six cation lig- ands are main-chain oxygen atoms, and three are the side-chain oxygen atoms of N296, E342 and S387. The glutamic acid and asparagine ... b-ketoacyl-ACP synthases I and II, and a domain of human fatty acid synthase, have a Cys-His-His triad and also a completely conserved Lys in the act...
Ngày tải lên: 19/02/2014, 08:20
Báo cáo khoa học: Fatty acid composition of chylomicron remnant-like particles influences their uptake and induction of lipid accumulation in macrophages pot
... are enriched in SFAs, MUFAs, n)6 PUFAs and n)3 PUFAs [23], as well as containing a range of other fatty acids, and these enrichments in u- ence the uptake and metabolism of the particles by the liver ... CRLPs containing high concentrations of oleate may be metabolized more readily than TG from the other types of CRLP, caus- ing an increase in the release...
Ngày tải lên: 16/03/2014, 12:20
Tài liệu Báo cáo khoa học: Fatty acid desaturases from the microalga Thalassiosira pseudonana pptx
... CATATCTGAAGTGTGAGCG TpdesI GAGAATGCCAAGTTGGAG TGTTGCAACACTTCCACGG TpdesK GTGTGAGTTATGGAACGAAG CTACTCACACTTGGCTTTAC TpdesM GATTCATCCGTATCATAATAGTAAG TGGAACCTATGCCACCAC TpdesN GTGAGAGCACTAACCAAGCTT CAATCAGTAGGCTTCGTCG TpdesO ... GAGAGGAAGTTCCGTCCTTG CAACGCAATCAATGAACGC TpdesB GTATGGATGCTACCGATG TGAATGTACAGATTGAACCT TpdesE GAGTTGATGAAGACATTGCG CTCCAACTGGTATTGCATTC TpdesG GATACTTCTTCATCTTGCACG CA...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo khoa học: Fatty acid omega-oxidation as a rescue pathway for fatty acid oxidation disorders in humans pot
... acylcar- nitine translocase and carnitine palmitoyltransferase II [5–7]. In case of the straight-chain and 2-methyl-branched chain FAs, b-oxidation can start right away via the well-established cascade of four ... by all-trans retinoic acid (ATRA) in the hepatoma cell line HepaRG was shown to decrease CYP 4A1 1 gene and protein expression, ultimately leading to a decre...
Ngày tải lên: 22/03/2014, 16:21
Báo cáo khoa học: Amino acid biosynthesis and metabolic flux profiling of Pichia pastoris ppt
... 4, 170–181. 41. Takada, Y. & Noguchi, T. (1985) Characteristics of alanine: glyoxylate aminotransferase from Saccharomyces cerevisiae ,a regulatory enzyme in the glyoxylate pathway of glycine and serine biosynthesis ... employed 13 C-labeling strategy (see text), its reactions are depicted in grey. The amino acids and the carbon fragments originating from a single...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: Fatty acid regulation of adenylyl cyclase Rv2212 from Mycobacterium tuberculosis H37Rv doc
... eluci- dated (see scheme in Fig. 6A) . In the active state (pH 6), the catalytic domains align as a closed dimer capable of binding ATP and of catalysis. In the in- active state (pH 8), the catalytic ... the inhibited state, the catalytic domains are recruited by the N-terminal domains and unable to bind ATP. In Rv2212, fatty acids and a pH shift synergiz...
Ngày tải lên: 30/03/2014, 10:20