báo cáo khoa học: "Combinatorial peptidomics: a generic approach for protein expression profiling" potx

... details were the same. Values for each individual peptide were calculated as individual peak areas taken relative to the average peak areas from the 5 peptides (not-containing Met) for each separate ... fired and the resulting mass spectra were averaged to produce each final trace. For the relative quantitation study each graph was obtained from 3 separate mass spectra taken from three...

Ngày tải lên: 11/08/2014, 00:22

... tsA58T Ag cDNA carry- ing the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotak...

Ngày tải lên: 18/02/2014, 17:20

... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTG...

Ngày tải lên: 07/03/2014, 16:20

... lexical sample format, which is an XML–based format that has been used for both the S ENSEVAL-2 and SENSEVAL-3 exercises. A file in this format includes a number of instances, each one made up ... stage, per- forms a transformation on the data, and then passes on the processed data structures to the next stage in the pipeline. We have created a protocol that defines the structure and...

Ngày tải lên: 08/03/2014, 04:22

... AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG PPP6C-forward AGGGAATTCATGGCGCCGCTAGACCTGGC PPP6C-reverse GAGGCCTCGAGTCAAAGGAAATATGGCGTTG MicroRNA-373 functions as an oncogene ... TTTTTATTGTGGAGTATGCTGCTGAAATG PPP6C-3¢UTR-mut-antisense ATTTCAGCAGCATACTCCACAATAAAAAG PPP6C-siR-Top GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA PPP6C-siR-Bottom AGCTT...

Ngày tải lên: 14/03/2014, 23:20

... Pollard, Cad / Sag, Ivan (1987) Infor- mation-Based Syntax and Semantics, I: Funda- mentals. Stanford, Calif.: CSLI. Shieber, Smart M. (1986) An Introduc- tion to Unification-Based Approaches ... regularities using default inheritance, and exceptions, overriding. DATR axioms consist of node-path pairs associated with a right-hand side. This can be a value (atomic or lis0, or...

Ngày tải lên: 18/03/2014, 02:20

... 2723–2729. 13 Akagi K, Kanai M, Saya H, Kozu T & Berns A (2001) A novel tetracycline-dependent transactivator with E2F4 transcriptional activation domain. Nucleic Acids Res 29, E23. 14 Ivanova L, Brandli ... repressor Markus Bach 1 , Silke Grigat 1 , Barbara Pawlik 1 , Christian Fork 1 , Olaf Utermo ¨ hlen 2 , Sonia Pal 1 , David Banczyk 1 , Andreas Lazar 1 , Edgar Scho ¨ mig 1,3 and...

Ngày tải lên: 23/03/2014, 09:21

... http://info.ox.ac.uk/bnc/ performed validation checks. The same happens for corpora that have been manually revised. As regards sentence separation, Johansson et al. (1996) mention that proofreading of the automatic ... situation: After having noted that several paragraphs in a row including title and author tags were usually wrong (and should have been marked as list items instead), we l...

Ngày tải lên: 23/03/2014, 19:20

... disciplines as multi-scalar analysis, of which fractal analysis is a variant. Although a certain amount has been written about the fractal or hierarchical nature of language, approaches to co-occurrence ... necessarily have similar ar- eas, as a correlation coefficient describes a sym- metric relationship. The diagram therefore says nothing about the amount of information cap- tur...

Ngày tải lên: 24/03/2014, 03:20

... ranking of candidate transitions. Treating backtracking as a ranking problem has several attractive features. It may combine global and local syntactic and semantic information related to each ... only method that applies ranking rather than some probability-based algorithm for backtracking. This aspect is critical for classification-based parsing oracles that do not yield a probabilit...

Ngày tải lên: 30/03/2014, 21:20