báo cáo khoa học: "Detection of DNA mismatch repair proteins in fresh human blood lymphocytes - towards a novel method for hereditary non-polyposis colorectal cancer (Lynch syndrome) screening" doc

... of DNA mismatch repair proteins in fresh human blood lymphocytes - towards a novel method for hereditary non-polyposis colorectal cancer (Lynch syndrome) screening. Journal of Experimental & ... ATP-dependent interaction of human mismatch repair proteins and dual role of PCNA in mismatch repair. Nucleic Acids Research 1998...

Ngày tải lên: 10/08/2014, 10:21

... AGAAATGGCCACCTGCATTTGAGAAAATAAAGTTTCATGCAGAAGAAAGTGACATGTTAA BCR-ABL1 junction in KU812 chr22:23,632,850 - chr9:133,643,198 ATTACAGGCAGGAGCCACTGTGCCCGGCCTGACCTCATATTTGAATACCGAGTTTTAGTT CTGGAGGAGCTGCAGGTTTTATTTGGGGAGGAGGGTTGCAGCGGCCGAGCCAGGGTCTCC ... chr22:23,632,613 GCAGCGGCCGAGCCAGGGTCTCCACCCAGGAAGGACTCATCGGGCAGGGTGTGGGGAAAC AGGGAGGTTGTTCAGATGACCACGGGACACCTTTGACCCTGGCCGCTGTGGAGTGGGT...

Ngày tải lên: 11/08/2014, 12:21

... suggests 5'-P 3'-blocking group 3'-OH 5'-dRP 3'-OH 5'-P 3'-OH 5'-P 3'-OH 5'-P FEN1-PCNA Polβ and/or Polδ/ε-PCNA Base damage AP site Monofunctional DNA ... types of DNA damage are associated with DNA base alteration. A well-characterized DNA base modification is uracil, which can arise in genomic DNA by misincorporation of dUMP...

Ngày tải lên: 16/03/2014, 13:20

...

Ngày tải lên: 07/08/2014, 20:23

... Endo-b-galactosidase mostly releases Neu- Aca 2-3 Galb 1-3 [Fuca 1-4 ]GlcNAcb 1-3 Gal and NeuAca 2- 3Galb 1-3 GlcNAcb 1-3 Gal from such O-glycans of BxPC3 membranes, but GlcNAcb 1-3 Gal and type 2 chain oligo- saccharides, ... a disaccharide and a monosaccharide, and was thus identified as a mixture of Galb 1-4 [Fuca 1-3 ]Glc- NAcb 1-3 Gal and Galb 1-3 [Fuca...

Ngày tải lên: 19/02/2014, 12:20

... S13 3A- AS, S13 3A- S13 4A- S ⁄ S13 3A- S13 4A- AS and S134D-S ⁄ S134D-AS pairs of primers (Table S2). Transformation of yeast cells with recombinant plasmids was performed as described in [37]. Purification ... HA-tagged Sch9p was immunoprecipitated with the anti-HA resin from 500 lg (total proteins) of a lysate of strain SCH9-HA (lane 1). As a reference, the anti-HA resin was...

Ngày tải lên: 07/03/2014, 04:20

... replaced with alanine, producing two single-mutant proteins (Ser1 6- Ala and Ser127Ala) and a double-mutant protein (Ser16AlaSer127Ala). In this article, we report that the replacement of both invariant ... Because of the weak bind- ing of (oxidized) FMN, all mutant proteins were iso- lated in their apo-form. The apparent stability of all three mutant proteins was compa...

Ngày tải lên: 07/03/2014, 05:20

... 1H-benzotriazol-1-yl-oxy-tris(pyr- rolidino)phosphonium hexafluorophosphate (PyBop) or O-(7-azabenzotriazol-1-lyl )-1 ,1,3,3-tetramethyluronium hexa- fluorophosphate as coupling r eagents in d imethylforma- mide. ... 2004 Folding of epidermal growth factor-like repeats from human tenascin studied through a sequence frame-shift approach Francesco Zanuttin, Corrado Guarnaccia, Alessandr...

Ngày tải lên: 23/03/2014, 13:20

... Detection of nucleolar organizer and mitochondrial DNA insertion regions based on the isochore map of Arabidopsis thaliana Ling-Ling Chen 1 and Feng Gao 2 1 Laboratory for Computational Biology, Shandong ... it a model plant for research [16]. The compositional organization of the A. thaliana genome has been studied by several groups [5,7]. Carels and Bernardi analyzed the cont...

Ngày tải lên: 30/03/2014, 20:20

... Kitazumi I, Maseki Y, Nomura Y, Shimanuki A, Sugita Y & Tsukahara M (2010) Okadaic acid induces DNA fragmentation via caspase-3-dependent and caspase-3-independent pathways in Chinese hamster ovary ... 118–127. 17 Enari M, Sakahira H, Yokoyama H, Okawa K, Iwamatsu A & Nagata S (1998) A caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD. Natu...

Ngày tải lên: 14/02/2014, 22:20