Development of a liposomal nanodelivery system for nevirapine ppsx

Development of a liposomal nanodelivery system for nevirapine ppsx

Development of a liposomal nanodelivery system for nevirapine ppsx

... cited. Research Development of a liposomal nanodelivery system for nevirapine Lakshmi N Ramana 1 , Swaminathan Sethuraman 1 , Udaykumar Ranga 2 and Uma M Krishnan* 1 Abstract Background: The treatment ... 10.1186/1423-0127-17-57 Cite this article as: Ramana et al., Development of a liposomal nanodelivery system for nevirapine Journal of Biomedical Science 20...

Ngày tải lên: 10/08/2014, 05:21

9 359 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA 22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT 23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC 24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA 25 ATATTATATATATATATAGGGTCGTATATA 26 AAATTATAGAAAGCAGTAGA TAAAACAATG 27 CTTCGAAGAATATACTAAAAAATGAGCAGG CAAGATAAACGAAGGCAAAGTTCAATTCA TCATTTTTTTTTTATTCTTTT 28 ... GCCCGGATCCTGATAGTAATAGAATCCAAA 4 CCCCGAATTCAAATTATAGAAAGCAGTAGA 5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC 6 A...

Ngày tải lên: 16/03/2014, 01:20

9 444 0
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx

Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx

... not readily available (Zhao et al., 2010). In contrast, bilingual parallel data is in abundance and has been used in extracting paraphrase (Ban- nard and Callison-Burch, 2005; Zhao et al., 2008b; Callison-Burch, ... issues are also raised in (Zhao and Wang, 2010) about using automatic metrics: paraphrase changes less gets larger BLEU score and the evaluations of paraphrase quality and rate...

Ngày tải lên: 23/03/2014, 14:20

5 347 0
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx

Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx

... SDS/PAGE. Autoradio- graphy was carried out on a BAS-IP NP 2040P imaging plate. Radioactivity was monitored with a Fujix BAS 2000 scanner (Raytest, Straubenhardt). Gel documentation was accomplished ... radioactivity. Photolysis of ATB-[His12]Svg (12)40) , and its radioactively labeled analog 125 I-labeled ATB-[His12]Svg (12)40) Photolysis was performed at a wavelength of 360 nm usi...

Ngày tải lên: 31/03/2014, 08:20

7 345 0
Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

... (principal component analysis and isomap method) Brain plan evaluation for (a) ANFIS and (b) human planFigure 7 Brain plan evaluation for (a) ANFIS and (b) human plan. The DVHs are shown in (c). ANFIS ... human planner does. Although interacting with the TPS at the level of deliverable plans Prostate plan evaluation for (a) ANFIS and (b) human planFigure 6 Prostate plan evaluation fo...

Ngày tải lên: 09/08/2014, 10:20

16 511 0
Báo cáo y học: "Validation of a microwave radar system for the monitoring of locomotor activity in mic pptx

Báo cáo y học: "Validation of a microwave radar system for the monitoring of locomotor activity in mic pptx

... purposes) Journal of Circadian Rhythms Open Access Research Validation of a microwave radar system for the monitoring of locomotor activity in mice Vittorio Pasquali*, Eugenio Scannapieco and Paolo Renzi Address: ... temper- ature of 21°C, and water and food ad libitum. Each animal was video-recorded with a Sony Handycam videocamera situated 30 cm above the cage (Figure 6). A...

Ngày tải lên: 10/08/2014, 09:20

8 586 0
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx

Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx

... P2 (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele- specific primer s Pnf (AGCATTTGGTTTTAAATTATG- GAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA). The PCR was run for 35 cycles ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelofibrosi...

Ngày tải lên: 10/08/2014, 21:23

7 436 0
Báo cáo y học: "Development of a synoptic MRI report for primary rectal cancer" ppsx

Báo cáo y học: "Development of a synoptic MRI report for primary rectal cancer" ppsx

... surgery that will be required to achieve this negative margin [7]. To date, magnetic resonance imaging (MRI) is widely available and an accurate imaging modality for rectal can- cer staging and pre-operative ... post-operative chemoradiation [3,4,6]. Therefore, accurate staging of rectal cancer at the time of diagnosis is essential in order to assess the need for pre-operative chemora...

Ngày tải lên: 11/08/2014, 05:21

6 440 0
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

... Management Framework - Introd uced Marine Pests Priorities and hazards for Economies  Variable levels of activity and management capability  Ships’ ballast water and hull fouling are ... important vectors  International shipping, aquaculture and biodiversity are most threatened values  Amount of commercial shipping and number of trading partners affecting pathway streng...

Ngày tải lên: 28/10/2013, 11:15

10 584 0
w