báo cáo khoa học: "Expression of a quantitative character radius incompletus, temperature effects, and localization of a mobile genetic element Dm-412 in Drosophila melanogaster" pptx
... Drosophila melanogaster, quantitative character, temperature hereditary effects, mobile genetic elements localization patterns. Résumé Expression d’un caractère quantitatif (radius ... pairs, which were the most similar by the tree (fig. 7). Expression of a quantitative character radius incompletus, temperature effects, and localization...
Ngày tải lên: 09/08/2014, 22:22
... reconstruction. Case report: We present the case of a 70-year-old Caucasian man wi th a metachronous metastasis of colon cancer and infiltration of the uncinate pancreatic process, on the anterior surface of ... SH: Pancreatoduodenectoma with vascular reconstruction in treating carcinoma of the pancreatic head. Hepatobiliary Pancreat Dis Int 2004, 3:612-615. 8. O’Sullivan AW...
Ngày tải lên: 10/08/2014, 23:20
... product and 5% remaining substrate). For additional details see main text. Peak heights are standardized by the data processing software, such that total peak integrals of different lanes are not ... interesting strategies in molecular biology, genome analysis and possibly molecular medicine. It is cer- tainly advantageous having a number of twin-ribozyme variants that can be adap...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo khoa học: "Machine Aided Error-Correction Environment for Korean Morphological Analysis and Part-of-Speech Tagging" pptx
... augmented case, such as '~(saram)/ncn+da'un/ncpa', '2 ,-7, (hag'gyo)/ncn+da'un/ncpa'. Correction rule can apply to the many kinds of word phrase; while manual log ... Run automatic POS tagging. 5. Detect unknown word error and suggest a correct candidate word. 6. Act according to reaction of human tagger - approving modificaton or not, receivi...
Ngày tải lên: 08/03/2014, 05:21
Báo cáo khoa học: Helicobacter pylori single-stranded DNA binding protein – functional characterization and modulation of H. pylori DnaB helicase activity pptx
... Japan) for quantitation. Helicase assay The substrate for helicase assay was prepared by annealing a 29 mer oligo (5¢-CCAAAACCCAGTCACGACGTTGT AAAACG-3¢) to M13mp18 single-stranded circular DNA. This ... 196, 87–93. 27 Handa P, Acharya N, Thanedar S, Purnapatre K & Varshney U (2000) Distinct properties of Mycobacte- rium tuberculosis single-stranded DNA binding protein and its functi...
Ngày tải lên: 30/03/2014, 02:20
Báo cáo khoa học: "Incidental thyroid lesions detected by FDG-PET/CT: prevalence and risk of thyroid cancer" ppsx
... remaining two. Two patients with a cytological diagnosis of a malignant neoplasm or an indeterminate nodule underwent operative interven- tion. A papillary cancer was found in one patient and a follicular ... The malignancies were papillary carcino- mas in 21 patients and follicular carcinomas in two patients. The patients included 17 women and 6 men with a mean age 53...
Ngày tải lên: 09/08/2014, 04:21
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt
... and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG CTGTACATCAAGGA; alpha smooth muscle actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: ... CACGAG-3¢;TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5 ¢-CAGACCC ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; c...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc
... PstI and SalI CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc Antisense ARS with PstI and SalI gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG TOP ... gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG TOP Ccttctccccggcggttagtgctgagagt...
Ngày tải lên: 18/02/2014, 12:20
Tài liệu Báo cáo khoa học: Expression of an a-1,3-glucanase during mycoparasitic interaction of Trichoderma asperellum docx
... °Cin 50 mm sodium acetate for 30 min and then measuring the remaining enzymatic activity adding mutan. For optimum pH determination phosphate buffer was used at pH values between 2 and 3, acetate ... MD, Mateos PF, Bridge PD, Monte E & Garcı ´ a- Acha I (1997) Physiological and biochemical characterization of Trichoderma harzianum, a biological control agent against soilborne f...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx
... connecting strand b3 to helix a1 and two small h elices (a4 anda6). The catalytic site consists of a functional catalytic triad found in all serine enzymes of the a/ b hydrolase fold family in which ... of a catalytic nucleophile serine, associated to a proton c arrier histidine and a c harge r elaying aspartic (or glutamic) acid. To further investigate the biochemical...
Ngày tải lên: 07/03/2014, 16:20