Báo cáo khoa hoc:"Food resource allocation patterns in lactating females in a long-term selection experiment for litter size in mice" pot

Báo cáo khoa hoc:"Food resource allocation patterns in lactating females in a long-term selection experiment for litter size in mice" pot

Báo cáo khoa hoc:"Food resource allocation patterns in lactating females in a long-term selection experiment for litter size in mice" pot

... non-reproductive and lactating animals as a source of variation in RFI. Indeed, the maternal body has to adapt greatly to the process of lactation. Apart from an increase in mammary size, lactating mice and ... 10.1051/gse:2001005 Original article Food resource allocation patterns in lactating females in a long-term selection experiment for litter size...

Ngày tải lên: 09/08/2014, 18:21

22 206 0
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS2 pot

Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS2 pot

... VAC materials available regionally and internationally; construction of questionnaire and interviewing of existing farming communities who are participating in the traditional VAC systems, selection ... appropriate improved VAC guidelines and manuals for household aquaculture in the North Central of Vietnam. iii) To build capacity for improved VAC application among stakeholders...

Ngày tải lên: 21/06/2014, 04:20

7 352 1
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS4 pptx

Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS4 pptx

... modified VAC farming operations. 7. Provide technical training in Australia for two Vietnamese scientists (planed in October or November, 2009) 8. Finalisation of the final MAS internal reporting ... Building A capacity building initiative has commenced at CEDMA. The transfer of technology in the area of water RAS, nutrient recycling across various farming components of VAC pra...

Ngày tải lên: 21/06/2014, 04:20

8 417 0
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS7 pptx

Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS7 pptx

... Quang Xuong, Thanh Hoa Snake-head in tanks and cages Mr. Hieu Quang Giao, Quang Xuong, Thanh Hoa Snake-head in tanks and cages Mr. Nam Quang Giao, Quang Xuong, Thanh Hoa Snake-head in ... (each province has 1 visit, especially Quang Tri had 2 visit) • 16 participants in Hue, 60 participants in Quang Tri, 16 participants in Ha Tinh, 30 participants in Nghe An, and 85...

Ngày tải lên: 21/06/2014, 04:20

13 344 0
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities - Milestone 5 " ppt

Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities - Milestone 5 " ppt

... but are of an area less than 200m 2 particularly in areas of limited access to water, • Availability of raw materials (eg manures from cattle and/or poultry in the area), • Suitable for culture ... temperature decreases in winter, grass or banana leaves can be applied to cover the surface to maintain temperature and prevent mass mortality. Light can be applied to increase temper...

Ngày tải lên: 21/06/2014, 04:20

15 413 0
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS8 ppt

Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS8 ppt

... be achieved. In making such decisions, markets and skills available were also considered. An example of such a situation is a farm in Ha Tinh where the water surface area was greater than three ... Hue, 3 in Quang Binh, 4 in Ha Tinh, 1 in Nghe An, and 4 in Thanh Hoa). See Appendix 1 for the final economic analysis summary. Six high value aquatic species were introduced...

Ngày tải lên: 21/06/2014, 04:20

9 481 0
Báo cáo khoa học: Mitochondria regulate platelet metamorphosis induced by opsonized zymosan A – activation and long-term commitment to cell death potx

Báo cáo khoa học: Mitochondria regulate platelet metamorphosis induced by opsonized zymosan A – activation and long-term commitment to cell death potx

... Coutinho PM & Henrissat B (1999) Carbohydrate- active enzymes: an integrated database approach. In Recent Advances in Carbohydrate Bioengineering (Gil- bert HJ, Davies B, Henrissat B & ... the general acid residues in the entire superfamily (Table 2). Chitosanase as a resistance determinant against antimicrobial action of chitosan The finding that a heterologous chitosanase c...

Ngày tải lên: 16/03/2014, 04:20

13 382 0
Báo cáo khoa học: Novel b-1,3-, 1,6-oligoglucan elicitor from Alternaria alternata 102 for defense responses in tobacco docx

Báo cáo khoa học: Novel b-1,3-, 1,6-oligoglucan elicitor from Alternaria alternata 102 for defense responses in tobacco docx

... Alternaria alternata 102 was kindly provided by K Takatori (National Institute of Health Sciences, Tokyo, Japan). A. alternata 102 maintained on a PDA slant (potato dextrose agar; Franklin Lakes, ... (F)TCGCCTTGTGGAAGTTTGAGAC (R)AACATTGTCACCAGGGAGTGCC 665 56 acidic PR-3 M29868 (F)CAGGAGGGTATTGCTTTGTTAGGC (R)ATCTTCCACTGCGTCATTCCGTCC 356 58 basic PR-3 X16938 (F)GCCATAGGAGTGGACCTGCTAAAC (R)AA...

Ngày tải lên: 23/03/2014, 11:20

11 358 0
Báo cáo khoa học: The crystal structure of Thermoactinomyces vulgaris R-47 a-amylase II (TVA II) complexed with transglycosylated product potx

Báo cáo khoa học: The crystal structure of Thermoactinomyces vulgaris R-47 a-amylase II (TVA II) complexed with transglycosylated product potx

... method to form a complex between TVA II and a pullulan model substrate by using partial hydrolyates of pullulan and an inactive TVA II mutant, D325N. A hexasaccharide containing two panose units, ... primer: 5¢-GATCACACTCTCGCG AAACA AATAATTCATCACCG-3¢. The underlined nucleotide in the primer indicates the mismatched nucleotide creating the alanine substitution mutation. DNA sequencing...

Ngày tải lên: 23/03/2014, 12:20

9 361 0
Báo cáo khoa học nông nghiệp " Commercial and High Quality Cultivars of Root and Tuber Crops for Processing Purpose in the Northern and Central Vietnam " potx

Báo cáo khoa học nông nghiệp " Commercial and High Quality Cultivars of Root and Tuber Crops for Processing Purpose in the Northern and Central Vietnam " potx

... production and suggestion Data in Table 2 show that in Thanhhoa and Bacgiang province sweet potato was mainly cultivated in the winter season. However, in Quangtri province, sweet potato was largely ... Quangtri, mainly as a winter crop in Thanhhoa and as a winter and spring crop in Bacgiang. • Farmers in all investigated localities needed new, high yielding varieties wi...

Ngày tải lên: 21/06/2014, 04:20

27 396 0
Từ khóa:
w