Báo cáo khoa học: " A specific inhibitor of protein kinase CK2 delays gamma-H2Ax foci removal and reduces clonogenic survival of irradiated mammalian cells" pot

Báo cáo khoa học: " A specific inhibitor of protein kinase CK2 delays gamma-H2Ax foci removal and reduces clonogenic survival of irradiated mammalian cells" pot

Báo cáo khoa học: " A specific inhibitor of protein kinase CK2 delays gamma-H2Ax foci removal and reduces clonogenic survival of irradiated mammalian cells" pot

... protein kinase CK2 delays gamma-H2Ax foci removal and reduces clonogenic survival of irradiated mammalian cells. Radiation Oncology 2011 6:15. Submit your next manuscript to BioMed Central and take ... potential therapeutic target, DNA double-strand break (DSB) formation and rejoining, apoptosis induction and clonogenic survival was assessed in irradiate...

Ngày tải lên: 09/08/2014, 09:20

13 289 0
báo cáo khoa học: " A rice calcium-dependent protein kinase is expressed in cortical root cells during the presymbiotic phase of the arbuscular mycorrhizal symbiosis" pps

báo cáo khoa học: " A rice calcium-dependent protein kinase is expressed in cortical root cells during the presymbiotic phase of the arbuscular mycorrhizal symbiosis" pps

... epidermal cells are also particularly useful for analysis of plasma membrane proteins because the environmental conditions can be manipulated to cause plasmolysis and par tial separation of th e plasma ... of plant CPKs and CCaMKs. Amino acid sequences from rice (Os), wheat (Ta), maize (Zm) and Medicago (M. truncatula, Mt; M. sativa, Ms) were aligned. Black and gray backgrounds...

Ngày tải lên: 11/08/2014, 11:20

14 723 0
Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx

Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx

... CCAATGCGCCTGCCGCAGGACTAGCG Glu168 fi Ala Up: CAGCACTCGTCGCGGTCCATACCGAG Down: CTCGGTATGGACCGCGACGAGTGCTG Val169 fi Ala Up: CACTCGTCGAGGCCCATACCGAGCAG Down: CTGCTCGGTATGGGCCTCGACGAGTG His170 fi Ala ... CGTCGAGGTCGCTACCGAGCAGGAAG Down: CTTCCTGCTCGGTAGCGACCTCGACG Asn189 fi Ala Up: GGTGATTGGCGTTGCCGCCCGCGACC Down: GGTCGCGGGCGGCAACGCCAATCACC Arg191 fi Ala Up: GCGTTAACGCCCGGCACCTCATGACG Down: CGTCATGAGG...

Ngày tải lên: 07/03/2014, 03:20

11 440 0
Báo cáo khoa học: A novel retinol-binding protein in the retina of the swallowtail butterfly, Papilio xuthus docx

Báo cáo khoa học: A novel retinol-binding protein in the retina of the swallowtail butterfly, Papilio xuthus docx

... from dark-adapted or light-adapted retinas, and analyzed by HPLC. The molar ratio of all-trans,11-cis and 13-cis 3-hydroxyretinol was then calculated based on the absorbance and the molar extinction coefficient ... of the light- and dark-adapted retinas, and analyzed by HPLC. The molar ratio of all-trans,11-cis and 13-cis 3-hydroxyretinol was then calculated based on the absor...

Ngày tải lên: 17/03/2014, 03:20

10 596 0
Báo cáo khoa học: A thermoacidophilic endoglucanase (CelB) fromAlicyclobacillus acidocaldariusdisplays high sequence similarity to arabinofuranosidases belonging to family 51 of glycoside hydrolases ppt

Báo cáo khoa học: A thermoacidophilic endoglucanase (CelB) fromAlicyclobacillus acidocaldariusdisplays high sequence similarity to arabinofuranosidases belonging to family 51 of glycoside hydrolases ppt

... Bactero- ides ovatus: AAA50391, arabinosidase 1; AAA50393, arabinosidase 2; Bifidobacterium longum NCC2705: AAN24035, BL0181; AAN24368, AbfA1; AAN24945, BL1138; AAN24971, AbfA2; AAN25400, AbfA3; Caulobacter ... sterco- rarium: AAC28125, arabinofuranosidase; Cytophaga xylanolytica: AAC38456, arabinofuranosidase I; AAC38457, arabinofuranosidase II; F. succinogenes S85: AAC45377, EGF; G. stearoth...

Ngày tải lên: 17/03/2014, 10:20

10 401 0
Báo cáo khoa học: A chloroplast RNA binding protein from stromal thylakoid membranes specifically binds to the 5¢ untranslated region of the psbA mRNA potx

Báo cáo khoa học: A chloroplast RNA binding protein from stromal thylakoid membranes specifically binds to the 5¢ untranslated region of the psbA mRNA potx

... relative to the AUG): T7-psbB5¢ (5¢-GTAATACGACTCACTATAGGGTAAATTAATT TAATTTAAAATC-3¢)andpsbB3¢ (5¢-TACACGATA CCAAGGTAAACC-3¢). Each template contained the pro- motor of the T7 RNA polymerase fused to ... the AUG); T7–36ntA5¢ (5¢-GTAATACGACTCACTATAGG GTTTACGGAGAAATTAAAAC-3¢) and 2054; M1- RNA (sequence of the psbA mRNA corresponding to positions )36 to +13 relative to the AUG with an exch...

Ngày tải lên: 17/03/2014, 11:20

8 338 0
Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx

Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx

... 2 and 7, Raphanus sativus; lanes 3 and 8, Brassica rapa; lanes 4 and 9, B. rapa var. glabra; lanes 5 and 10, B. oleracea var. italica. The amount of protein applied was 4 lg for A. thaliana and ... a pair of primers (forward, 5¢-CACCACCACCACCAGATGGGTTACTGGAATTCCA AG-3¢; reverse, 5¢-GTGGTGTTTCATATGTATATCTCCT TCTTAAAGTTAAAC-3¢; italic type shows the His-tag adaptor sites). Af...

Ngày tải lên: 23/03/2014, 07:20

16 424 0
Tài liệu Báo cáo khoa học: "A Composite Kernel to Extract Relations between Entities with both Flat and Structured Features" ppt

Tài liệu Báo cáo khoa học: "A Composite Kernel to Extract Relations between Entities with both Flat and Structured Features" ppt

... Natural Language Data. ACL-2003 Zelenko D., Aone C. and Richardella A. 2003. Kernel Methods for Relation Extraction. Journal of Ma- chine Learning Research. 2003(2):1083-1106 Zhao S.B. and ... viewpoint and integrated various tasks such as POS tagging, NE tagging, syntactic parsing, template extraction and relation extraction using a generative model. Feature-based methods...

Ngày tải lên: 20/02/2014, 12:20

8 467 0
Tài liệu Báo cáo khoa học: A synthetic weak neurotoxin binds with low affinity to Torpedo and chicken a7 nicotinic acetylcholine receptors docx

Tài liệu Báo cáo khoa học: A synthetic weak neurotoxin binds with low affinity to Torpedo and chicken a7 nicotinic acetylcholine receptors docx

... regions of genes encoding Wntxs. The first pair was X289 (5¢ TgTgCTACTTgCC CTggAA 3¢)andX191. The second pair was X133 (5¢ TCC AgAAAAgATCgCAA gATg 3¢) [35] and X300 (5¢ AgAgC CAAgCTTTTACT ATCggTT ... Electrical signals after amplification were collected and digitized, at a sampling rate of 25 kHz, with the aid of a computer equipped with an analogue-to-digital interface board (DT2...

Ngày tải lên: 21/02/2014, 03:20

10 395 0
Báo cáo khoa học: "A Corpus for Modeling Morpho-Syntactic Agreement in Arabic: Gender, Number and Rationality" docx

Báo cáo khoa học: "A Corpus for Modeling Morpho-Syntactic Agreement in Arabic: Gender, Number and Rationality" docx

... 55(3):189– 213. Mohamed Altantawy, Nizar Habash, Owen Rambow, and Ibrahim Saleh. 2010. Morphological Analysis and Generation of Arabic Nouns: A Morphemic Func- tional Approach. In Proceedings of the seventh ... thank Mona Diab, Owen Rambow, Yuval Marton, Tim Buckwalter, Otakar Smrž, Reem Faraj, and May Ahmar for helpful discussions and feedback. We also would like to especially...

Ngày tải lên: 07/03/2014, 22:20

6 378 0
w