Báo cáo y học: "Defective CD4+CD25+ regulatory T cell functioning in collagen-induced arthritis: an important factor in pathogenesis, counter-regulated by endogenous IFN-γ" potx

Báo cáo y học: "Defective CD4+CD25+ regulatory T cell functioning in collagen-induced arthritis: an important factor in pathogenesis, counter-regulated by endogenous IFN-γ" potx

Báo cáo y học: "Defective CD4+CD25+ regulatory T cell functioning in collagen-induced arthritis: an important factor in pathogenesis, counter-regulated by endogenous IFN-γ" potx

... experiments we tested the importance of T reg cells in the pathogenesis of CIA by rendering wild-type mice deficient in T reg cells by treating the mice with deplet- ing anti-CD25 antibody. Starting ... regulatory T cell functioning in collagen-induced arthritis: an important factor in pathogenesis, counter-regulated by endogenous IFN-γ Hilde Kelchte...
Ngày tải lên : 09/08/2014, 06:22
14 403 0
Báo cáo y học: "The role of regulatory T cells in antigen-induced arthritis: aggravation of arthritis after depletion and amelioration after transfer of CD4+CD25+ T cells" doc

Báo cáo y học: "The role of regulatory T cells in antigen-induced arthritis: aggravation of arthritis after depletion and amelioration after transfer of CD4+CD25+ T cells" doc

... 4 Modulation of antigen-induced arthritis (AIA) by transfer of regulatory T cells (T reg cells)Modulation of antigen-induced arthritis (AIA) by transfer of regulatory T cells (T reg cells). ... With this in mind, it could be interesting to investigate whether the accumu- lated T reg cells in patients with arthritis function properly in vivo and whether these patients...
Ngày tải lên : 09/08/2014, 06:22
11 440 0
Báo cáo y học: "Are CD4+CD25-Foxp3+ cells in untreated new-onset lupus patients regulatory T cells" doc

Báo cáo y học: "Are CD4+CD25-Foxp3+ cells in untreated new-onset lupus patients regulatory T cells" doc

... Foxp3 in CD4 + CD25 - T cells. Competing interests The authors declare that they have no competing interests. Authors' contributions HY and WZ developed the study, analyzed the data, and drafted ... are different from Tregs, both phenotypically and functionally. Materials and methods Patients and healthy controls Twenty-two UNOL patients of Chinese ethnicity (19 women and 3 men) were...
Ngày tải lên : 09/08/2014, 14:22
9 373 0
Báo cáo y học: "Does CD4+CD25+foxp3+ cell (Treg) and IL-10 profile determine susceptibility to immune reconstitution inflammatory syndrome (IRIS) in HIV disease" pdf

Báo cáo y học: "Does CD4+CD25+foxp3+ cell (Treg) and IL-10 profile determine susceptibility to immune reconstitution inflammatory syndrome (IRIS) in HIV disease" pdf

... Mason D: Regulatory T cells in the control of autoimmunity: the essential role of transforming growth fac- tor b and interleukin 4 in the prevention of autoimmune thryroiditis in rats by peripheral ... in the function of regulatory T cells that inhibit intestinal inflammation. J Exp Med 1999, 190:995-1004. 27. Read S, Malmstrom V, Powrie F: Cytotoxic T lymphocyte-associ- a...
Ngày tải lên : 11/08/2014, 08:21
5 337 0
Báo cáo y học: " Polychromatic immunophenotypic characterization of T cell profiles among HIV-infected patients experiencing immune reconstitution inflammatory syndrome (IRIS)" doc

Báo cáo y học: " Polychromatic immunophenotypic characterization of T cell profiles among HIV-infected patients experiencing immune reconstitution inflammatory syndrome (IRIS)" doc

... solely the responsibility of the authors and does not necessarily represent the official views of the Fogarty International Center or the National Institutes of Health. We wish to thank all of the ... experiencing TB-IRIS [12], our data suggest that T cell activation markers may be indicative of an underlying opportunistic infection and may prove a useful biomarker for identifying pat...
Ngày tải lên : 10/08/2014, 05:21
9 253 0
Báo cáo sinh học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition potx

Báo cáo sinh học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition potx

... virus; vvtetOA12L: A12L mutant virus; Tet: Tetracycline; TetO: Tetracycline operator. Competing interests The author(s) declare that they have no competing inter- ests. Acknowledgements This work ... (underlined), 5'- CTTAATTCTCAAACAGATGTGACTATCGACATC TGTGA- TACAAAATCAAAGAGTTCA-3'. The AG/A site-mutated A12L was inserted in pRB21 vector. For transfection of the plasmids into T- R...
Ngày tải lên : 18/06/2014, 18:20
6 397 0
Báo cáo hóa học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition" pdf

Báo cáo hóa học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition" pdf

... Tet: Tetracycline; TetO: Tetracycline operator. Competing interests The author(s) declare that they have no competing inter- ests. Acknowledgements This work was supported by NIH research grant ... 5'- CTTAATTCTCAAACAGATGTGACTATCGACATC TGTGA- TACAAAATCAAAGAGTTCA-3'. The AG/A site-mutated A12L was inserted in pRB21 vector. For transfection of the plasmids into T- REx 293 cells,...
Ngày tải lên : 20/06/2014, 01:20
6 401 0
Báo cáo Y học: Defective translocation of a signal sequence mutant in a prlA4 suppressor strain of Escherichia coli doc

Báo cáo Y học: Defective translocation of a signal sequence mutant in a prlA4 suppressor strain of Escherichia coli doc

... and other SRP substrates to the SecY protein in the translocon is not defective in the prlA4 mutant. (G-10L)prePhoE is inefficiently translocated in the prlA4 mutant Whereas the targeting of the ... (G-10L)prePhoE and other SRP substrates to the translocon is apparently unaffected in the prlA4 mutant, their subsequent insertion into the mutant translocon might be impaired. To test this...
Ngày tải lên : 08/03/2014, 09:20
9 493 0
Báo cáo y học: "Rapid CD4 decline after interruption of non-nucleoside reverse transcriptase inhibitor-based antiretroviral therapy in a resource-limited setting" ppt

Báo cáo y học: "Rapid CD4 decline after interruption of non-nucleoside reverse transcriptase inhibitor-based antiretroviral therapy in a resource-limited setting" ppt

... resistance. Treatment interruption (TI) in patients with high CD4 cell counts, lipodystrophy, and limited options may be an alternative in resource-limited settings. This study aimed to determine ... Giam- benedetto S, Antinori A, International Study Group on CD4- monitored Treatment Interruptions. International Study Group on CD4-monitored Treatment Interruptions: CD4 cell- monitore...
Ngày tải lên : 10/08/2014, 05:20
6 360 0
Báo cáo y học: "Imbalanced effector and regulatory cytokine responses may underlie mycobacterial immune restoration disease" pot

Báo cáo y học: "Imbalanced effector and regulatory cytokine responses may underlie mycobacterial immune restoration disease" pot

... that presents later [8-10]. Immunity to mycobacterial infections is influenced by the counteracting effects of effector cytokines and regulatory cytokines, such as interleukin (IL)-10, in patients ... delayed-type hypersensitivity (DTH) response to mycobacterial antigens is a characteristic find- ing [1,5,6], and coincides with excessive production of Type 1 (Th1) cytokines [7], probabl...
Ngày tải lên : 10/08/2014, 05:21
5 171 0