cd4 and cd8 t cell depletion in the thymus
Báo cáo y học: " HIV-1 infection and CD4 T cell depletion in the humanized Rag2-/-γc-/- (RAG-hu) mouse model" docx
Ngày tải lên :
13/08/2014, 09:20
... found to have CD4 T cell depletion to below 50% of normal at weeks postinfection To further investigate CD4 T cell depletion at the infected tissue level, thymus from an uninfected control and infected ... antibodies against the human panleukocyte marker CD45 at 12 weeks postengraftment (B) Cells stained with antibodies against the T cell markers CD3 and CD4 (C) Cells stained with antibodies against the ... displayed a more sustained CD4 T cell depletion at 6, 9, 11, 20, 24 and 30 weeks post-infection (up until the last time point evaluated) The differences and fluctuations in CD4 T cell depletion levels...
- 14
- 216
- 0
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
Ngày tải lên :
13/08/2014, 01:20
... aggccacatcctagttctgc GBP1R tccaggagtcattctggttgt BDLvsVIR CD8 -2.5 -2.4 ACTA2 NM_001613.1 actin, alpha 2, smooth muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 ... pathogenesis warrants further investigation Together, these observations imply that different cell subsets differ in their pace towards disease progression and the way they maintain distinct ... genes from the gene set TCA cycle within the ranked list Top, the running enrichment score for the gene set as the analysis walks along the ranked list The score at the peak of the plot is the enrichment...
- 21
- 376
- 0
Báo cáo hóa học: " Decreased level of recent thymic emigrants in CD4+ and CD8+T cells from CML patients" pdf
Ngày tải lên :
18/06/2014, 16:20
... acceptor site and subsequently the sjTREC was cloned in to the EcoRV restriction site of the TOPO TA Vector (Invitrogen, Groning, The Netherlands) Based on the DNA concentration, measured by spectrophotometry ... [22,23] In order to further evaluate the T- cell immune function, the T cell proliferative history in CML patients was analyzed The sjTRECs-content in PBMCs and CD3+ T cells from 48 CML cases was determined ... percentage of CD3+cells in the analyzed samples Furthermore, we analyzed sjTRECs in sorted CD4+ and CD8+ T cells This is the most sensitive and accurate method for quantitation of naïve T- cells It...
- 8
- 367
- 0
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf
Ngày tải lên :
20/06/2014, 01:20
... it is not the virus bearing the epitope nor local virus replication that results in the decreased functionality of CD8+ CTL in lungs, but rather the pulmonary site of residence of the cells Therefore, ... declare that they have no competing interests Authors' contributions JMD carried out the experiments and wrote the manuscript BRM and PLC provided advice and wrote the manuscript AB conceived the study, ... (% of total CD8+ cells) Days after primary (secondary) infection Lung Tet +CD8+ /total CD8+ , % Spleen IFNγ +CD8+ /total CD8+ , % Tet +CD8+ /total CD8+ , % IFNγ +CD8+ /total CD8+ , % Primary Infectiona Mockb...
- 8
- 381
- 0
Báo cáo khoa học: "Density of CD4(+) and CD8(+) T lymphocytes in biopsy samples can be a predictor of pathological response to chemoradiotherapy (CRT) for rectal cancer" ppt
Ngày tải lên :
09/08/2014, 09:20
... attracts T cells [28] In a previous study, we found that the circulating lymphocyte count is correlated with tumor response to CRT [13] This finding is in line with the data in this study, and ... chemotherapy [17] However, in our literature search, there are no report to evaluate the correlation between TIL and radiosensitivity, and this is the first one to show the direct link between the ... CD8 As shown in Figure 1, both CD4 and CD8 were clearly stained in the cell membrane of interstitial infiltrates In most cases, CD4( +) or CD8( +) T cells were evenly distributed in the whole tissue...
- 6
- 371
- 0
Báo cáo y học: " The intracellular detection of MIP-1beta enhances the capacity to detect IFN-gamma mediated HIV-1-specific CD8 T-cell responses in a flow cytometric setting pro" ppsx
Ngày tải lên :
10/08/2014, 05:21
... http://www.aidsrestherapy.com/content/5/1/22 CD8 T- cells The assay has the capacity to detect the cytokines IFN-γ and IL-2, the chemokine MIP-1β and the activation marker CD154 For the characterization ... evaluation equivalent to the measurement of the total IFN-γ producing T- cells with the relevant advantage of a consistent decrease of the background that in turn increases the sensitivity of the ... rare Since the analysis of the combination of two functions decreases the background and the measurement of the IFN-γ+ MIP-1β+ T- cells was equivalent to the measurement of the total IFN-γ+ T- cells,...
- 13
- 379
- 0
Báo cáo y học: " Antibody microarray analysis of cell surface antigens on CD4+ and CD8+ T cells from HIV+ individuals correlates with disease stages" ppt
Ngày tải lên :
13/08/2014, 05:22
... blood T- cell cytotoxicity found in HIV infection [41] These findings, together with ours, support the hypothesis that the CD8+ T cells from LNTP may have stronger cytotoxic activity than those ... indicate that the cells have recently cycled On the other hand, the upregulation of both CD57 and CD71 in the VIR group may indicate the activation rather than the cell proliferation index [28] Since ... that they have no competing interests 11 Authors' contributions JQW fully performed the work, analyzed data and wrote the paper BW contributed to the writing LB and JC analyzed data, did statistical...
- 13
- 289
- 0
The role of interferon gamma in regulating antigen specific CD8 t cell responses in a mouse model of influenza
Ngày tải lên :
10/09/2015, 09:25
... 1.1) The HA and the NA are the two large spike-like glycoproteins on the surface of the virus HA is a lectin that mediates the binding of the virus to target cells and facilitates the entry of the ... preventing the release of viral RNPs from the M1 protein, and ultimately into the host cell The M1 protein is present beneath the lipid-envelope and is the most abundant protein in the virion It ... whereas the adaptive immunity takes days to be initiated and then for the response to peak In the interim, it is the innate immune response that combats viral replication in the initial phase of the...
- 263
- 427
- 0
báo cáo hóa học: " Cyclooxygenase-2 mediates microglial activation and secondary dopaminergic cell death in the mouse MPTP model of Parkinson''''s disease" pptx
Ngày tải lên :
19/06/2014, 22:20
... against MPTP-induced neurotoxicity and behavioral deficits This study was conducted in attempt to fill in the gap within the literature on the effects of COX-2 inhibition in protecting SNpc dopaminergic ... the testing protocol, and the results from the habituation period suggest that mice adjust to the setup very quickly and that the habituated level of activity is much lower than the first-time ... locomotor balance and coordination was measured using the Rotarod test after the mice were able to habituate to the machine and the procedure Pre-training ensured that all the mice could walk on the...
- 16
- 468
- 0
Báo cáo y học: "Defective CD4+CD25+ regulatory T cell functioning in collagen-induced arthritis: an important factor in pathogenesis, counter-regulated by endogenous IFN-γ" potx
Ngày tải lên :
09/08/2014, 06:22
... [3-5] The CD4+ CD25+ Treg cell population constitutes to 10% of the mature CD4+ cell population in the adult thymus and the peripheral lymphoid tissue and blood In vitro, CD4+ CD25+ Treg cells inhibit ... exerted in part via ACs Competing interests The author(s) declare that they have no competing interests Authors' contributions BDK, HK and TM performed the CIA induction and evaluation HK, MVB and ... experiments we tested the importance of Treg cells in the pathogenesis of CIA by rendering wild-type mice deficient in Treg cells by treating the mice with depleting anti-CD25 antibody Starting from...
- 14
- 403
- 0
Báo cáo y học: " Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART" doc
Ngày tải lên :
10/08/2014, 05:22
... little is known about the change of CD8+ cell subsets during early period of ART In this study we investigated the dynamic changes not only in CD8+ cell subsets, but also in their activation and ... Activation of CD8+ cell subsets We next investigated the effect of ART on T cell activation HIV-infected individuals had higher T- cell activation in the blood as indicated by expression of HLA-DR and ... and data acquisition HZ conceived the study and participated in the data analysis HW supervised and coordinated the study All authors have read and approved the final manuscript Competing interests...
- 7
- 338
- 0
Báo cáo y học: "Escape is a more common mechanism than avidity reduction for evasion of CD8+ T cell responses in primary human" pdf
Ngày tải lên :
13/08/2014, 01:20
... reduction in T cell response avidity occurred in acute and early HIV infection, to gain insight into the potential impact of these two mechanisms on T cell- mediated containment of virus replication at ... of the epitope at the indicated timepoint (day (d) FOSx is shown Areas of amino acid variation within the epitope are indicated in bold italics and underlined the virus population within the ... by the primary CD8+ T cell response in the patient where they were selected than the corresponding index sequence peptide, i.e the half-maximal stimulatory concentration of the mutant peptide...
- 13
- 370
- 0
Báo cáo y học: "Viral suppression of multiple escape mutants by de novo CD8+ T cell responses in a human immunodeficiency virus-1 Infected elite suppressor" ppt
Ngày tải lên :
13/08/2014, 01:21
... variants Representative dot plot and histogram shown for stimulation with one of the autologous mutants, TSTLTEQVAW (top left) and wild type TW10 (top right) Gating is on CD8+ T cells (bottom) Total ... escape mutations in other HLA-B*57 restricted Gag epitopes In addition to mutating TW10 to express each of the seven plasma variants, we mutated the epitope to express the T2 42N mutation and to express ... (Figure 2b) The proviral-derived Gag had no mutations in either the IW9 or TW10 epitopes, suggesting that mutations in the HLA-B*57 restricted epitopes are not the only factors impacting the fitness...
- 7
- 273
- 0
Báo cáo y học: "Isolated receptor binding domains of HTLV-1 and HTLV-2 envelopes bind Glut-1 on activated CD4+ and CD8+ T cells" pot
Ngày tải lên :
13/08/2014, 09:21
... Glut-1 that is not present at the cell surface In support of the latter hypothesis, Baldwin and colleagues have elegantly shown that cytokines and other growth signals induce the translocation ... not recognize endogenous Glut-1 on these cells Notably, the ability of HTLV-1 and HTLV-2 derived RBDs to bind to parental and transfected 29 3T cells correlated with the data obtained using the ... environment in which Glut-1 is expressed in distinct cell types in order to determine the parameters that condition HTLV envelope binding and subsequent infection Identification of cellular factors that...
- 9
- 283
- 0
Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx
Ngày tải lên :
08/03/2014, 02:20
... Consequently, tyrosines located on the peptides may be expected to exhibit the same kinetics as those located on the intact protein Therefore, determination of the kinetics of phosphorylation of these ... 1N to be the first phosphorylated Differences arising in the order of phosphorylation of the subsequent tyrosines in the whole cTCRf chain in vitro, relative to the single-tyrosine-containing ... electrostatic interactions in SH2 domain recognition: salt dependence of tyrosyl-phosphorylated peptide binding to the tandem SH2 domain of the Syk kinase and the single SH2 domain of the Src kinase...
- 8
- 570
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
Ngày tải lên :
18/06/2014, 16:20
... Additionally, the T cells found in the blood, whether it be in their repertoire, function and state of activation, may not accurately reflect the status and behavior of their counterparts localized in the ... pathogenic CD4+ Teff cells, and in turn, driving the functional homeostasis of CD4+ Foxp3+ Treg cells in the target organ IL-2 restores the Treg/Teff balance in T1 D IL-2 is important in instructing Treg ... [16,45] These results indicate that the lack of Treg cells in IL-2-/- and IL-2R-/- mice contributes to the autoimmune phenotype and that IL-2 maintains self tolerance by increasing the number of Treg...
- 12
- 573
- 0
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc
Ngày tải lên :
18/06/2014, 16:20
... recognize the importance of CD4+ T cells and the possibility that these cells may influence the outcome of vaccine protocols with respect to PD-1 expression by CD8 + T cells PD-1 and co-inhibitory ... priming, the epitopespecific CD8+ T cells, although few in numbers (~1/100 specific/total CD8+ T cells), had some strikingly distinguishing features Within the population of CD8+ T cells initiated ... would not result in a deleterious anti-vector immunity The priming strategy could then be matched with heterologous vectors that expand and/ or differentiate the primed cells to therapeutically useful...
- 11
- 505
- 0
báo cáo hóa học:" Metabolic and anthropometric parameters contribute to ART-mediated CD4+ T cell recovery in HIV-1-infected individuals: an observational study" potx
Ngày tải lên :
20/06/2014, 08:20
... distribution in CD4 gain after ART supports the hypothesis that, in addition to viral suppression alone, other factors may determine the extent of immune reconstitution on ART Immunology measurements ... past studies, we tested whether including in this model the frequency of CD95+ CD8+ T cells, the only activation term individually associated with the CD4 outcome, would improve the predictivity ... interview Written informed consent was obtained from all participants as per University of the Witwatersrand Ethics Committee- and Wistar Institute Institutional Review Board-approved study protocol...
- 9
- 469
- 0
Báo cáo y học: "The relationship between predicted peptide–MHC β class II affinity and T-cell activation in a HLA-DRβ1*0401 transgenic mouse model" pptx
Ngày tải lên :
09/08/2014, 01:21
... different peptide sequences that share the properties of binding to DR4 and that presented similar amino acids to the TCR could activate the same population of T cells The two peptides we studied ... by the TCR In addition to the altered MHC contact surface, it has been shown that a conserved substitution of the peptide side-chain interacting with P6 can essentially abrogate T- cell recognition ... from the antigenic peptides are buried within the MHC binding groove whereas others point away from this groove and make contacts with the TCR [25–28] These TCR contact positions are found at P2,...
- 9
- 530
- 0
Báo cáo y học: "Heterogeneity of CD4+ and CD8+ memory T cells in localized and generalized Wegener’s granulomatosis." potx
Ngày tải lên :
09/08/2014, 01:21
... on CD4+ CD45RO+ and CD8 +CD45 RO+ and also on CD4+ CD45RA+ and CD8 +CD45 RA+ T cells indicates activation and the potential to respond to chemotactic gradients in inflammatory areas, which is consistent ... described Thus, the local cytokine milieu might depend on the site and extent of disease activity [4,5] The shift in the cytokine profile in granulomatous lesions of the respiratory tract might be ... E- and P-selectin and Available online http://arthritis-research.com/content/5/1/R25 ICAM-1 expressed on the endothelial side, and the β2integrin LFA-1 on T cells [5,19] In addition to the steps...
- 7
- 354
- 0
Xem thêm