Báo cáo khoa học: "Recouvrance hygrothermique du bois vert I Influence de la température Cas du jujubier (Ziziphus lotus (L) Lam) J Gril, B Thibaut, E Berrada G Martin" ppsx
Báo cáo khoa học: "Recouvrance hygrothermique du bois vert. I. Influence de la température. Cas du jujubier (Ziziphus lotus (L) Lam) J Gril, B Thibaut, E Berrada G Martin" ppsx
... hygrothermique < /b> du < /b> bois < /b> vert.< /b> I.< /b> Influence < /b> de < /b> la < /b> température.< /b> Cas < /b> du < /b> jujubier< /b> (Ziziphus < /b> lotus < /b> (L) < /b> Lam)< /b> J < /b> Gril,< /b> B Thibaut, E Berrada G MartinUniversité de < /b> Montpellier 2, Laboratoire ... le «zig-zag»d’un nombre limité d’essais, car l’objectifétait d’en déduire moins des donnéesfiables sur la < /b> RHT du < /b> jujubier < /b> que des en-seignements en préliminaire à des ... d’étudierl influence < /b> de < /b> la < /b> température < /b> et de < /b> mettreen évidence les différents mécanismescontribuant à la < /b> déformation thermique du< /b> bois < /b> vert.< /b> Original articleRecouvrance hygrothermique...
- 14
- 244
- 0
Báo cáo khoa học: "Recouvrance hygrothermique du bois vert. Il. Variations dans le plan transverse chez le châtaignier et l’épicéa et modélisation de la fissuration à coeur provoquée par l’étuvage" pdf
... les mesures. Influence < /b> du < /b> bois < /b> de < /b> réactionL’analyse de < /b> l influence < /b> du < /b> bois < /b> de < /b> tensiondans la < /b> figure 9 ne peut se faire en défini-tive qu’à partir des 4 points de < /b> ... intrees. In: Springer Series in Wood Science (E Timell, ed) Springer Verlag, Berlin Berrada E (1991) Recouvrance hygrothermique< /b> du < /b> bois < /b> vert.< /b> Thèse de < /b> doctorat de < /b> l’universi-té ... l’étuvage J < /b> Gril,< /b> E Berrada, B ThibautLaboratoire de < /b> mécanique et g nie civil, université de < /b> Montpellier 2, CP 81, place Eugène-Bataillon,34095 Montpellier cedex 5, France(Reçu le 30...
- 22
- 297
- 0
Báo cáo khoa học: "Variabilité géographique et estimation des paramètres génétiques de la croissance en hauteur de jeunes sapins de Céphalonie" doc
... de < /b> St -J< /b> rôme, institut méditerranéen d’écologieet de < /b> paléoécologie, laboratoire de < /b> botanique et écologie méditerranéenne,avenue Escadrille-Normandie-Niemen, 13397 Marseille ... àpartir des individus du < /b> verger à graines de < /b> St-Lambert, qui est le seul à posséder une struc-ture combin e provenances-descendances ma-ternelles individualisées. Les nombres ... g nétique to-tale est inférieure à celle qui est due à la< /b> variabilité familiale et individuelle, mais elleest suffisante pour qu’apparaissent des dif-férences significatives...
- 17
- 254
- 0
Báo cáo khoa học "ĐÁNH GIÁ HỆ SỐ SỨC KHÁNG CHO MỘT SỐ PHƯƠNG PHÁP DỰ BÁO SỨC CHỊU TẢI CỦA CỌC CỦA TCXD 205:1998 " docx
... “Tiêu chuẩn thiết kế cầu”. 3. Federal Highway Administration, “Load and Resistance Factor Design (LRFD) for Highway Bridge Substructures - Reference Manual and Participant Workbook”, Publication ... Publication No. FHWA HI-98-032, 2001. 4. Transportation Research Board, “Calibration to Determine Load and Resistance Factors for Geotechnical and Structural Design”, Washington D.C, 2005. 5. Viện ... thuật, ĐH Kiến trúc Hà N i,< /b> 2011. 9. S. YOON et al, “LRFD calibration of axially-loaded concrete piles driven into soft soils”, Transportation Research Board Annual Meeting, Washington, D.C,...
- 5
- 1,347
- 6
Báo cáo khoa học: CHUẩN HOá PHƯƠNG PHáP SàNG LọC Định TíNH KIểM SOáT TồN DƯ KHáNG SINH TRONG THựC PHẩM Có NGUồN GốC ĐộNG VậT THEO QUI ĐịNH Số 2002/657/EC pptx
... described in the European Legislation, the CRL (Community Reference Laboratory) of Fougères (France) wrote guidelines and recommendations to validate screening methods. The objective of this review ... the medico-lega domain, it is necessary to be able to guarantee the liability and the traceability of the provided results. The accuracy and the agreement of the results of analyses coming ... analytical validation of screening methods for the control of antibiotic residues in food from animal origin according to the decision 2002/657/EC Phạm Kim Đăng1, Marie-Louise Scippo2; Guy Degand2;...
- 9
- 598
- 0
BÁO CÁO KHOA HỌC: "SO SÁNH TÁM GIỐNG KHOAI TÂY TRỒNG Ở ĐIỀU KIỆN TRUNG DU VĨNH PHÚC VỀ QUANG HỢP VÀ NĂNG SUẤT" pdf
... Solara have the least potential. Our Comparing eight patato breeds in productivity shows that: Eben, CV38.6 and Redstar produce the highest yield; KT3, Mariella and Diamont produce the medium ... and Mariella have the least. Regarding the photosynthesis, Eben, Redstar and Diamont have the greatest capacity for photosynthesis; KT3, Mariella and CV 38.6 have the medium capability; HH7 ... lượng micromol CO2 được hấp thụ trên 1m2 lá trong 1 giây b ng máy chuyên dụng LCi của hãng ADC BioScientific Ltd - Anh. M i < /b> công thức SUMMARY Comparison eight patato breeds in the soil midland...
- 12
- 711
- 0
Báo cáo khoa học: "Lý thuyết xác suất áp dụng trong phân tích rủi ro dự án" pps
... ==n 1i< /b> iiXP)X (E trong đó: E( X): Kỳ vọng toán học của biến ngẫu nhiên X X i< /b> : Giá trị của biến ngẫu nhiên X ở lần thống kê thứ i < /b> P i< /b> : Xác suất xuất hiện giá trị X i< /b> của biến ngẫu nhiên ... risk analysis methods are constructed based on the theory. This paper aims to present statistic theory and the methodology to apply it to project risk analysis. i.< /b> Các kh i < /b> niệm về xác suất ... suất thống kê thì kỳ vọng toán học của một biến ngẫu nhiên là giá trị trung b nh trọng số của biến ngẫu nhiên v i < /b> trọng số là xác suất xuất hiện một giá trị nào đó của biến ngẫu nhiên xem xét....
- 6
- 554
- 0
Tài liệu Báo cáo khoa học: Mechanisms of obesity and related pathologies: Androgen deficiency and endothelial dysfunction may be the link between obesity and erectile dysfunction pptx
... male obesity. In summary, considerable evi-dence exists linking obesity to reduced TT levels[18,41,58–67]; however, detailed pathophysiologicalmechanisms of obesity-induced androgen de< /b> ciencyand ... decrease in FTinvolves elevated serum leptin levels in individuals withlarge fat reserves. In obese individuals, elevated leptinlevels may interfere with LH ⁄ human chorionic gona-dotropin-stimulated ... testosterone is significantly exacer-bated in obese men with the metabolic syndrome.What are the implications for the relatively high inci-dence of erectile dysfunction observed in these men? J < /b> Urol...
- 13
- 662
- 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt
... nonheme Fe2+-dependent oxygenasethat cleaves b- diketonesStefan Leitgeb, Grit D. Straganz and Bernd NidetzkyInstitute of Biotechnology and Biochemical Engineering, Graz University of Technology, ... through a PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA as the forwardand reverse oligonucleotide primers, respectively. Theprimers were designed to introduce ... oxygenase; X-rayabsorption spectroscopy; b- diketonecleavageCorrespondenceBernd Nidetzky, Institute of Biotechnologyand Biochemical Engineering, GrazUniversity of Technology, Petersgasse...
- 15
- 624
- 0
Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ