Báo cáo y học: "TMZ-BioShuttle – a reformulated Temozolomide" pptx
Báo cáo y học: "Hypoalbuminaemia – A Marker of Cardiovascular Disease in Patients with Chronic Kidney Disease Stages II - IV"
... cardiovascular disease. In addition, data on food in- take, basal energy expenditure (BEE), and total daily energy expenditure (TEE) were not available for analysis that may have provided a ... demonstrated that hypoalbu- minemia was a strong predictor of mortality in dialysis patients. Kalantar-Zadeh et al (34) also showed higher mortality in dialysis patients with lower albumin. M...
Ngày tải lên: 03/11/2012, 11:52
Báo cáo Y học: Rodent a-chymases are elastase-like proteases pot
... 15, 43 1–4 40. 55.Jin,D.,Takai,S.,Yamada,M.,Sakaguchi,M.,Yao ,Y. & Miyazaki, M. (2001) Possible roles of cardiac chymase after myocardial infarction in hamster hearts. Jpn. J. Pharmacol. 86, 20 3–2 14. 56. Miyazaki,M.,Wada,T.,Shiota,N.&Takai,S.(1999)Effectofan angiotensin ... Biomedical Research, Hino, Tokyo, Japan; 2 TEIJIN Material Analysis Research Laboratories, Tokyo, Japan; 3...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx
... forward primer D1 1–1 3 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢)and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; ... forward primer F1 (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse pri- mer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPTB-NLD-I D4...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot
... arrow). Y5 1 AMY2 and Y8 2 TAA are in orange. Other binding residues (W9 AMY2 , H92 AMY2 , T94 AMY2 , A9 5 AMY2 , Y1 30 AMY2 , A1 45 AMY2 , F180 AMY2 , K182 AMY2 , W206 AMY2 , S208 AMY2 , Y2 11 AMY2 , ... AMY2/acarbose (Fig. 1A) . Superpositioning of AMY2 and TAA guided by the catalytic acids was excellent for Tyr51 AMY2 and Tyr82 TAA (Fig. 1A) and mutation in Saccharomycopsis fibuligera...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo Y học: LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1 docx
... cells transformed by X-ray, UV-C, and 3-methylcholanthrene, detected by a DNA fingerprint assay. Cancer Res. 52, 578 8–5 793. 12. Kitazawa, T., Kominami, R., Tanaka, R., Wakabayashi, K. & Nagao, ... cytoplasmic extraction. The same membrane was used for immunoblot analysis with aF-N, aF-C and anti- (a- tubulin) Ig. Lanes 1 and 4, whole cell lysate; lanes 2 and 5, cytoplasmic fraction;...
Ngày tải lên: 31/03/2014, 23:20
Báo cáo y học: "Fluoxetine: a review on evidence based medicine" pdf
... disorder: A meta-analysis. Acta Psychiatrica Scandinavica 2002, 106(3):163-167. 11. Khan A, Leventhal RM, Khan S, Brown WA: Suicide risk in patients with anxiety disorders: A meta-analysis of the FDA ... Barraco and Pietro Donda Address: Medical Dept. Eli Lilly Italia S.p .A. via Gramsci, 731, Sesto fiorentino (Florence), Italy Email: Andrea Rossi* - rossi_andrea _a@ lilly.com; Alessandr...
Ngày tải lên: 08/08/2014, 20:23
Báo cáo y học: "TMZ-BioShuttle – a reformulated Temozolomide" pptx
... demethylase in human prostate cancer. Mol Carcinog. 2002; 33: 163-71. 44. Nakayama M, Gonzalgo ML, Yegnasubramanian S, et al. GSTP1 CpG island hypermethylation as a molecular biomarker for ... et al. Effect of O6-benzylguanine on alkylating agent-induced toxicity and mutagenicity. In Chi- nese hamster ovary cells expressing wild-type and mutant O6-alkylguanine-DNA alkyltransferases. ....
Ngày tải lên: 08/08/2014, 17:20
Báo cáo y học: " A retrospective quality assessment of pre-hospital emergency medical documentation in motor vehicle accidents in south-eastern Norway"
... Norwegian Air Ambulance Foundation, Drøbak, Norway Full list of author information is available at the end of the article Staff and Søvik Scandinavian Journal of Trauma, Resuscitation and Emergency ... epidemiology: a study from Karachi, Pakistan. Prehosp Emerg Care 2005, 9:355-360. 23. Cordell WH, Olinger ML, Kozak PA, Nyhuis AW: Does anybody really know what time it is? Does anybody reall...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: " Facilitators and obstacles in pre-hospital medical response to earthquakes: a qualitative study"
... the air transport organization, to provide the evacuation by air. In addition they carried managers, medical teams and equipment to the earthquake area. A participant said “The air force managed ... this article as: Djalali et al.: Facilitators and obstacles in pre-hospital medical response to earthquakes: a qualitative study. Scandinavian Journal of Trauma, Resuscitation and Emergency Me...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: "The Systemic Inflammatory Response Syndrome (SIRS) in acutely hospitalised medical patients: a cohort study"
... among patients in a medical emergency ward. Materials and methods Patient population All acutely hospitalised medical patients admitted to the medical emergency ward as well as medical patients admitted ... study, obtained data, made the analysis, interpreted the data and wrote the first draft. MS and AL contributed to the design of the study and the interpretation of the data and made a...
Ngày tải lên: 25/10/2012, 09:56