Báo cáo toán học: "Subsums of a Zero-sum Free Subset of an Abelian Group" pptx

... 5 Research Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit Rob Shulman 1 , Mervyn Singer 2 , John Goldstone 3 and ... critically revising the draft. JG made substantial contributions to the data analysis. GB was substantially involved in the analysis, interpretation an...

Ngày tải lên: 25/10/2012, 10:39

... 2009 The Authors Journal compilation ê 2009 FEBS SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation Alpana Ray 1 , Srijita Dhar 1 , Arvind Shakya 1 , Papiya ... 3Â splice acceptor 1A 75 ATCTTCCAGgtaacaac 625 cacctcagGGTCACGCC 1C 87 CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA 364...

Ngày tải lên: 07/03/2014, 02:20

... and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3Â. YEp351 -SUT2 was constructed to contain SUT2 as the only open reading frame present in the plasmid in order ... polymerase chain reaction (PCR) using the primers disRAS2fwd 5Â-TAACCGT TTTCGAATTGAAAGGAGATATACAGAAAAAA AACAGCTGAAGCTTCGTACGC-3Â and disRAS2rev Correspondence to M. Ru ă tzler, Dep...

Ngày tải lên: 07/03/2014, 15:20

... cases and 800 000 deaths occur annually, making measles the most important cause of infant mortality worldwide. The low vaccine coverage and the low vaccine efficacy in the presence of maternal antibodies ... Biochem. 270) 1523 Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein...

Ngày tải lên: 08/03/2014, 08:20

... class="bi x0 y0 w1 h 1" alt =""

Ngày tải lên: 05/08/2014, 15:21

... bounds on the size of union-free families. the electronic journal of combinatorics 5 (1998), # R39 11 4 Lower bound on f We give a construction of a (strongly) union-free family of subsets of ... ≤ n  i=1 H(2p i − p 2 i ) ≤ nφ(p) (since pn =  p i ). Therefore αn ≤ 1 2 [β(p)+φ(p)+o(1)]n. New Bounds for Union-free Families of Sets Don Coppersmith (email: copper...

Ngày tải lên: 07/08/2014, 06:22

... with fixed letter frequencies We now consider the letter statistics of ternary square-free words. Denote the number of occurrences of the letter a in a ternary square-free word w n of finite length ... =1isalocalmaximumofP (). Due to the concavity of P (), it is the global maximum. the electronic journal of combinatorics 11 (2004), #R14 15 On the En...

Ngày tải lên: 07/08/2014, 08:20

... dependence of the coefficients of P n as (rational) functions of the z i . Noting that the coefficients of the change of basis from the arches to the spin up/spin down are constants and in particular independent ... nothing but the sum of generators of the Temperley–Lieb algebra, acting on the Hilbert space of link patterns π, i.e. planar diagrams of 2n point...

Ngày tải lên: 07/08/2014, 08:22

... A \ {a 3 , a 6 }, a 21 ∈ A \ {a 2 , a 14 , a 16 }, a 22 ∈ A \ {a 2 , a 5 , a 7 , a 11 , a 14 }, and a 23 ∈ A \ {a 2 , a 5 , a 7 , a 11 , a 14 , a 16 }. We distinguish four cases. Case 1: a 18 = ... with Lemma 2.4 shows that a 1 , a 2 , a 3 , a 4 , a 5 , a 6 , a 7 , a 8 , a 9 , a 10 , a 11 , a 12 , a 13 , a 14 , a 15...

Ngày tải lên: 07/08/2014, 21:20

... adjacency matrix o f G. Then the eigenvalues of G are defined as the eigenvalues of A. As all eigenvalues of A are real, we can rearra nge them as λ 1  ···  λ n . I. Gutman (see [9]) defined the energy ... eigenvalue. Then by [5, Theorem 6.7], G is a complete multipartite graph. As the r ank of a complete multipartite graph equals t he number of its parts, G must...

Ngày tải lên: 08/08/2014, 01:20

... configurations A general definition of rigged configuration of arbitrary types can be found in [14, Section 3.1]. Here we are only concerned with type A n rigged configurations and review their definition. Given ... Section 2, we review the definitions of crystal paths and rigged configurations, and state the main results of this paper. Theorem 2.38 shows that pr is the analogue...

Ngày tải lên: 08/08/2014, 12:22

... such a polygon do not change genus of such a surface. Operation 1: Aaa − ∼ A, Operation 2: AabBab ∼ AcBc, Operation 3: AB ∼ {(Aa), (a − B)}, A A a a A B a b b a A B c c A B A Bc c Figure 4: Operation ... attaching ears serially or by bar -amalgamation of a cactus to G N The authors of [5] discussed a Kuratowski type theorem for average genus of graph...

Ngày tải lên: 08/08/2014, 12:23

... 25:8-11. 14. White BE, Kaplan A, Lopez-Terrada DH, Ro JY, Benjamin RS, Ayala AG: Monophasic Synovial Sarcoma Arising in the Vulva. A Case Report and Review of the Literature. Arch Pathol Lab Med 2008, 132:698-702. 15. ... Kawaguchi S, Wada T, Ida K, Sato Y, Nagoya S, Tsukahara T, Kimura S, Sahara H, Ikeda H, Shimozawa K, Asanuma H, Torigoe T, Hiraga H, Ishii T, Tatezaki S...

Ngày tải lên: 09/08/2014, 03:23

Ngày tải lên: 09/08/2014, 13:22

... Central Page 1 of 9 (page number not for citation purposes) AIDS Research and Therapy Open Access Research LMP-420, a small-molecule inhibitor of TNF-alpha, reduces replication of HIV-1 and Mycobacterium ... Corresponding author Abstract Background: Co-infections of human immunodeficiency virus (HIV) and Mycobacterium tuberculosis (M. Tb) are steadily incr...

Ngày tải lên: 10/08/2014, 05:20