Báo cáo khoa học: "Altered expression of thioredoxin reductase-1 in dysplastic bile ducts and cholangiocarcinoma in a hamster model" pptx
Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx
... caused by ironloading has an impact in protein integrity, as indicatedby an increase in protein-bound acrolein adducts atthe cell surface, which point to acrolein-adducts as a reliable marker ... 5¢-GGGCACTCAGCCAGGGGACATCCTGCCCAA-3¢ as forward and 5¢-GATACAAGTTTGCACACCTTTGCACTTCTG-3¢ asreverse [58]. The PCR amplification was performed in a total volume of 50 lL reaction mix containing 1 l LofcDNA, 10 pmol of each ... immunoprecipitation and mRNA studies. (A) Cytospins of HepG2 cells were incubated with Nor3.2 followed by rabbit anti-(mouse Igs) and the alkaline phosphatase-antialkaline phos-phatase (APAAP) conjugate,...
- 14
- 682
- 0
Báo cáo khoa học: Altered expression of tumor protein D52 regulates apoptosis and migration of prostate cancer cells potx
... data were analysed using winmdi software(The Scripps Research Institute, La Jolla, CA, USA).Determination of caspase-3 and -9 activityCaspase-3 and -9 activities were measured 48 h after down-regulation ... determined theinvolvement of caspase activation and mitochondriamembrane depolarization. In many cell types, activa-tion of procaspase-3 is a distinguishing feature of apoptotic cell death. ... TPD52 expression in theandrogen responsive prostate cancer cell line LNCaP.It is an oncogene overexpressed in prostate, breast and ovarian cancer, as demonstrated by DNA microarrayanalysis and...
- 11
- 444
- 0
Báo cáo khoa học: Temporal expression of heat shock genes during cold stress and recovery from chill coma in adult Drosophila melanogaster pdf
... (forward) TGGATGAACCCACACCCAATC 89Hsp67Ba (reverse) CGAGGCAACGGGCACTTCHsp68 (forward) GAAGGCACTCAAGGACGCTAAAATG 88Hsp68 (reverse) CTGAACCTTGGGAATACGAGTGHsp70Aa (forward) TCGATGGTACTGACCAAGATGAAGG ... CTCCTCGTGCTTCCCCTCTACCHsp40 (forward) GAGATCATCAAGCCCACCACAAC 112Hsp40 (reverse) CGGGAAACTTAATGTCGAAGGAGACHsp60 (forward) ACATCTCGCCGTACTTCATCAACTC 66Hsp60 (reverse) GGAGGAGGGCATCTTGGAACTCHsp67Ba (forward) ... GGTGCCCTTCTATGAGCCCTACTAC 153Hsp23 (reverse) CCATCCTTTCCGATTTTCGACACHsp26 (forward) GTCACATCATGCGCCACTTTG 52Hsp26 (reverse) TTGTAGCCATCGGGAACCTTGTAGHsp27 (forward) GGCCACCACAATCAAATGTCAC 171Hsp27...
- 12
- 388
- 0
Báo cáo khoa học: Molecular imprinting of cyclodextrin glycosyltransferases from Paenibacillus sp. A11 and Bacillus macerans with c-cyclodextrin pptx
... Degree of derivatization of the CGTases from A1 1 and BM obtained with different protein ⁄ itaconic anhydride ratios and remaining cyclization activity.Ratio a (w ⁄ w)Paenibacillus sp. A1 1 Bacillus ... Sunnyvale, CA,USA) to analyze and quantify the CD products. A Carbo-pac PA-100 analytical column (4 · 250 mm; Dionex Corp.)was used. A sample (25 lL) was injected and eluted with a linear gradient ... 658–665.2 Yazdanparast R & Khodagholi F (2006) Kinetic aspects of alkaline phosphatase refolding in the presence of alpha-cyclodextrin. Arch Biochem Biophys 446, 11–19.3 Asanuma H, Hishiya T &...
- 10
- 562
- 0
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
... (5¢-TTT TTC TAG AGC AGG GTA GGTTGA TTT CAT GTC GAA TG-3¢; additional XbaI siteunderlined) and OB 3 (5¢-AAA AGA ATT CTT AGAAGT CCC AGT CAT CGT C-3¢; additional EcoRI siteunderlined).The amplified ... nrdF+gene was sequenced by a primer walkingapproach. For DNA analysis, dnastar software (DNAS-TAR Inc., Madison, WI, USA) and clone manager 5.0(Scientific & Educational Software, Cary, NC, USA) ... originally described as a manganese analogue [4] of the iron containing class I RNR of Escherichia coli. Thisassignment was based on an analysis of its metal compo-sition and similarity of its absorption...
- 14
- 872
- 0
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R)12 reverse CAAGGAGCGTTAGAATCTAAAG H1R13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R)14 reverse GATTTAAGTGGAGCGGAATGCTA ... 8 both forward ACAACACCACTGCTGCGGAGTTA J1F9 short reverse ACATCAAGGAGCGTTAGAATCTAA J2R 1201 (with J1F and J2R)10 long reverse GATTTAAGTGGAGCGGAATGCTA J3R 1385 (with J1F and J3R)Real time PCR ... & PCR 1 both forward GTGGACGTGATGGAGGATAAG A1 F 728 (with A1 F and A1 R)2 reverse GAAGGCACGCTGAGGAAGAC A1 R5’-RACE 3 both outer reverse GGATGAATGCCCAACTTCTCCC B13R4 both outer reverse ACGAAACCTGGCAGAGTCCAAG...
- 11
- 662
- 0
Tài liệu Báo cáo khoa học: Enhanced expression of Mcm proteins in cancer cells derived from uterine cervix docx
... Coomassie Brilliant Bluestaining.Table 2. Quantitation and comparison of proteins in GM and WI-38cells. From the data in Fig. 2 and others, the concentrations of Mcmproteins, ORC2 and PCNA in ... chromatin-bound proteins(Fig. 3 and Table 2). In contrast, the amounts of totalFig. 4. Abundance of Mcm2 mRNA in HeLa and WI-38 cells. (A) Total mRNA was purified from HeLa and WI-38 cells, and ... furthercharacterize the expression of Mcm4, PCNA and Ki67 in cancer cells, a section that contains a boundary region of CIS (CIN3 of FIGO classification) and dysplasia (CIN1)was immunostained (Fig....
- 13
- 486
- 0
Báo cáo khoa học: Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis pot
... Se,5¢-GGGAACAGAGCGGAUAGGATT-3¢; scrambled c-JunsiRNA2 Se, 5¢-GAAAGAUGGCAGAAUAGAATT-3¢; and scrambled c-Jun siRNA3 Se, 5¢-GAAAGCCUUAAGAAUUGUATT-3¢). The transfection of rat primary hepatocyteswith siRNA(s) was carried ... immunoprecipitates including DNA were analyzed byPCR (primers: Fw, 5¢-CCAGACAATCGTCTCGCCCA-3¢; and Rv, 5¢-GGCTAGGTAACAGTTTAGCGAGGA-3¢).Rat genomic DNA extracted from rat primary hepatocyteswas used as a ... species and apoptosis in rat primary hepatocytes. Apoptosis wasaccompanied by increased expression of BimEL, following activation of extracellular signal-regulated kinase. The aim of this study was...
- 9
- 556
- 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... using primers (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAA AATGGAGC AGAAA CTCATCTCTGAAGAGGATCTG -3¢) and (5¢- GCATGC CTGCAGGTCGACTCTAGAGGATCTCAAGCCAGTGACCGCCTCCC-3¢), and checked for the presence and ... (5¢-AGCTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAATTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAAAATGGAGCAGAAACTCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGTGACCGCCTCCC-3¢); ... was performed on DNAse-treated RNA extracts. Primers used for RT-PCR were: forthe I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AGCTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAATTTTGCTGCC-3¢);...
- 14
- 473
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP