Báo cáo khoa học: " Comparison of a small volume of hypertonic saline solution and dextran 40 on hemodynamic alternations in conscious calves" ppsx
... initial increase in circulating plasma volume, its moderate duration of effect and its low incidence of anaphylactic reaction. Therefore, administration of a small- volume D40 should be confirmed ... subjects. Acta Anaesthesiol Belg 1989, 40, 275-280. 21. Walker PG, Constable PD, Morin DE. Comparison of hypertonic saline- dextran solution and lactated Ringer’s...
Ngày tải lên: 07/08/2014, 18:21
... 6:606-613. 29. Pandey P, Avraham S, Place A, Kumar V, Majumder PK, Cheng K, Nakazawa A, Saxena S, Kharbanda S: Bcl-xL blocks activation of related adhesion focal tyrosine kinase/proline-rich tyrosine kinase ... survival after radiation. Gossypol and radiation activate the SAPK/JNK pathway Because SAPK/JNK-mediated signaling plays an important role in radiation-, chemotherapy- and en...
Ngày tải lên: 09/08/2014, 10:20
... hybridi- zation of an oligo microarray containing 20 371 mouse cDNAs. Scatter plot analysis of the microarray data showed that most of the data points fell along the diagonal, indicating that most of ... Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT. All experimental protoc...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc
... (5¢-GAATTCatgaaggttctcctccactg-3¢) and rO-MACS-XhoI-D (5¢-CTCGAGtgcccgtccccactcctggt-3¢) for o-macs; EcoRI-mMACS1-U (5¢-GAATTCatgcagtggc tgaagagttt-3¢) and mMACS1-XbaI-D (5¢-TCTAGAtagct gaccaaactccttg-3¢)forMACS1, ... Fujino, T., Takei, Y .A. , Sone, H., Ioka, R.X., Kamataki, A. , Magoori, K., Takahashi, S., Sakai, J. & Yamamoto, T.T. (2001) Molecular identification and characteriza...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: "PREDICTIVE COMBINATORS A METHOD PROCESSING OF COMBINATORY CATEGORIAL GRAMMARS" doc
... Study of Language and Information, Stanford University, Palo Alto, Calif. Sag, I. 1987. Grammatical Hierarchy and Linear Precedence. To appear in Syntax and Semantics, Volume 20: Discontinuous ... combinators, that replace the basic forms of functional composition and type raising in the original grammar. After first reviewing the theory of Combinatory Categorial Gra...
Ngày tải lên: 08/03/2014, 18:20
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG PPP6C-forward AGGGAATTCATGGCGCCGCTAGACCTGGC PPP6C-reverse GAGGCCTCGAGTCAAAGGAAATATGGCGTTG MicroRNA-373 functions as an oncogene in ... TTTTTATTGTGGAGTATGCTGCTGAAATG PPP6C-3¢UTR-mut-antisense ATTTCAGCAGCATACTCCACAATAAAAAG PPP6C-siR-Top GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA PPP6C-siR-Bottom...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx
... rate Me ´ lanie Hall, Prabuddha Bansal, Jay H. Lee, Matthew J. Realff and Andreas S. Bommarius School of Chemical and Biomolecular Engineering, Georgia Institute of Technology, Atlanta, GA, USA Introduction The ... crystallinity rather than adsorption on the enzymatic rate. Thus, the cellulase activity and initial rate data obtained from various samples may provide valuable inform...
Ngày tải lên: 15/03/2014, 10:20
Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx
... functional analysis of cystinosin, both as a sim- ple plate assay for the detection of functional muta- tions in CTNS and also as a genetic system to identify and characterize other genes that may ... topology of cystinosin. Magenta and blue dots represent those amino acids that are invariant in an alignment of representative cystinosin-related proteins from humans (AAH3...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: "Metaphor Comprehension - A special mode of language pptx
... theories of metaphor within linguistics and psychology. 4. CONCLUSIONS The final part of the paper examines the relationship between metaphor comprehension and existing language comprehension ... represent context information which was missing in the original input. The goal of the context construction procedure is to provide a context information in which the GCS-TKS c...
Ngày tải lên: 17/03/2014, 19:20
Báo cáo khoa học: Order within a mosaic distribution of mitochondrial c-type cytochrome biogenesis systems? pptx
... long-standing view that the diplomonads and parabasalids belong to the earliest diverging eukaryotic lineage [46,47,58] – comparative interrogations of various morphological and molecular character ... maturation (Fig. 3). Others (Trichomonas vaginalis and Giardia intestinalis) lack a capacity for respiration, and c-type cytochromes are accordingly absent from their degenerate mit...
Ngày tải lên: 23/03/2014, 07:20