0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: " Comparison of a small volume of hypertonic saline solution and dextran 40 on hemodynamic alternations in conscious calves" ppsx

Báo cáo khoa học:

Báo cáo khoa học: " Comparison of a small volume of hypertonic saline solution and dextran 40 on hemodynamic alternations in conscious calves" ppsx

... initial increase in circulating plasma volume, itsmoderate duration of effect and its low incidence of anaphylactic reaction. Therefore, administration of a small- volume D40 should be confirmed ... subjects. Acta Anaesthesiol Belg 1989, 40, 275-280.21. Walker PG, Constable PD, Morin DE. Comparison of hypertonic saline- dextran solution and lactated Ringer’s solution for resuscitating severely ... 0.14 l/min (Table 1, p < 0.001).DiscussionIntravenous infusion of a small volume of 10% dextran 40 in saline or 7.2% hypertonic saline solutions to normal, 3-months old Holstein calves were...
  • 6
  • 366
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " AT-101, a small molecule inhibitor of anti-apoptotic Bcl-2 family members, activates the SAPK/JNK pathway and enhances radiation-induced apoptosis" pdf

... 6:606-613.29. Pandey P, Avraham S, Place A, Kumar V, Majumder PK, Cheng K,Nakazawa A, Saxena S, Kharbanda S: Bcl-xL blocks activation of related adhesion focal tyrosine kinase/proline-rich tyrosinekinase ... survivalafter radiation.Gossypol and radiation activate the SAPK/JNK pathwayBecause SAPK/JNK-mediated signaling plays an importantrole in radiation-, chemotherapy- and environmentalstress-induced ... cell lines. The earliestGossypol and radiation activate the SAPK/JNK pathwayFigure 4Gossypol and radiation activate the SAPK/JNK pathway. A: AT-101 is a stronger activator of SAPK/JNK than racemic...
  • 10
  • 284
  • 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

... hybridi-zation of an oligo microarray containing 20 371 mousecDNAs. Scatter plot analysis of the microarray datashowed that most of the data points fell along thediagonal, indicating that most of ... Slc1 2a2 mRNA were designed asfollows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAATCACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACATCCTTGGTACCAGGTGATTTTTCTTGTGAAGAT.All experimental protocols described in ... binding site.Proc Natl Acad Sci USA 95, 14220–14225.18 Ohto H, Kamada S, Tago K, Tominaga S, Ozaki H,Sato S & Kawakami K (1999) Cooperation of Six and Eya in activation of their target...
  • 16
  • 476
  • 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

... (5¢-GAATTCatgaaggttctcctccactg-3¢) and rO-MACS-XhoI-D (5¢-CTCGAGtgcccgtccccactcctggt-3¢)for o-macs; EcoRI-mMACS1-U (5¢-GAATTCatgcagtggctgaagagttt-3¢) and mMACS1-XbaI-D (5¢-TCTAGAtagctgaccaaactccttg-3¢)forMACS1, ... Fujino, T., Takei, Y .A. , Sone, H., Ioka, R.X., Kamataki, A. ,Magoori, K., Takahashi, S., Sakai, J. & Yamamoto, T.T. (2001)Molecular identification and characterization of two medium-chain acyl-CoA ... within the rat olfactoryplacode. Recombinant O-MACS protein tagged with c-Myc and His6 demonstrated an acyl-CoA synthetase activity forfatty acid activation, and protein localization to mitochon-dria...
  • 10
  • 393
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "PREDICTIVE COMBINATORS A METHOD PROCESSING OF COMBINATORY CATEGORIAL GRAMMARS" doc

... Study of Language and Information, Stanford University, Palo Alto, Calif. Sag, I. 1987. Grammatical Hierarchy and Linear Precedence. To appear in Syntax and Semantics, Volume 20: Discontinuous ... combinators, that replace the basic forms of functional composition and type raising in the original grammar. After first reviewing the theory of Combinatory Categorial Grammar and the attendant ... numbers of such semantically equivalent derivations can multiply at an alarming rate. It was shown in Wittenburg (198 6a) that even constrained versions of func- tional composition and type raising...
  • 8
  • 354
  • 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATTTGATCTCTTGAACAAATTACTTACACAAAGAGPPP6C-forward AGGGAATTCATGGCGCCGCTAGACCTGGCPPP6C-reverse GAGGCCTCGAGTCAAAGGAAATATGGCGTTGMicroRNA-373 functions as an oncogene in ... TTTTTATTGTGGAGTATGCTGCTGAAATGPPP6C-3¢UTR-mut-antisense ATTTCAGCAGCATACTCCACAATAAAAAGPPP6C-siR-Top GATCCGCTTTGTGTAAGTAATTTGATTCAAGAATCAAATTACTTACAAGTTTTTTGAATTCTCGAGAPPP6C-siR-Bottom AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATTTGATCTCTTGAACAAATTACTTACACAAAGAGPPP6C-forward ... MicroRNA-373, a new regulator of protein phosphatase 6,functions as an oncogene in hepatocellular carcinomaNannan Wu*, Xuyuan Liu*, Xuemei Xu*, Xingxing Fan, Min Liu, Xin Li, Qiping Zhong and Hua...
  • 11
  • 396
  • 0
Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

... rateMe´lanie Hall, Prabuddha Bansal, Jay H. Lee, Matthew J. Realff and Andreas S. BommariusSchool of Chemical and Biomolecular Engineering, Georgia Institute of Technology, Atlanta, GA, USAIntroductionThe ... crystallinity rather than adsorption on the enzymaticrate. Thus, the cellulase activity and initial rate data obtained from varioussamples may provide valuable information about the details of ... chains from hindering oneanother [73]. At a very low CrI and constant adsorbedenzyme concentration, the percentage of surface cover-age is smaller because the surface area is larger atM. Hall...
  • 12
  • 554
  • 0
Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx

Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx

... functional analysis of cystinosin, both as a sim-ple plate assay for the detection of functional muta-tions in CTNS and also as a genetic system to identify and characterize other genes that may ... topology of cystinosin. Magenta and bluedots represent those amino acids that are invariant in an alignment of representative cystinosin-related proteins from humans (AAH32850.1),birds (Gallus gallus; ... at 10 A 600units per mL in NaCl ⁄ Pi and left on ice. FM4-64 was added to a final concentration of 20 lm, and was viewed immediately upon shifting the incu-bation temperature to 25 °C and after...
  • 15
  • 378
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Metaphor Comprehension - A special mode of language pptx

... theories of metaphor within linguistics and psychology. 4. CONCLUSIONS The final part of the paper examines the relationship between metaphor comprehension and existing language comprehension ... represent context information which was missing in the original input. The goal of the context construction procedure is to provide a context information in which the GCS-TKS connections are fully ... control structure to cope with the larger and richer knowledge domains which have to be handled. The main conclusion of the paper is that the notions of processing capacity, memory constraints...
  • 2
  • 311
  • 0
Báo cáo khoa học: Order within a mosaic distribution of mitochondrial c-type cytochrome biogenesis systems? pptx

Báo cáo khoa học: Order within a mosaic distribution of mitochondrial c-type cytochrome biogenesis systems? pptx

... long-standingview that the diplomonads and parabasalids belong tothe earliest diverging eukaryotic lineage [46,47,58] –comparative interrogations of various morphological and molecular character ... maturation (Fig. 3).Others (Trichomonas vaginalis and Giardia intestinalis)lack a capacity for respiration, and c-type cytochromesare accordingly absent from their degenerate mito-chondria, ... such as try-panosomes, Giardia and Trichomonas, as well as a diverse assortment of free-living protozoa, are included in the supergroup Excavata. The validity of this classi-fication was initially...
  • 18
  • 419
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP