Báo cáo khoa học: "Increased expression of neuronal nitric oxide synthase in astrocytes and macrophages in the spinal cord of Lewis rats with autoimmune encephalomyelitis" pps

Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

... compilation ª 2010 FEBS 4851 Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y ã ) ... Auling G (1998) Clon- ing and sequencing of the nrdF gene of Corynebacterium ammoniagenes ATCC 6872 encoding the functional met...

Ngày tải lên: 15/02/2014, 01:20

14 873 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan probe 18S TGGACCGGCGCAAGACGGAC AB Fig. ... Journal compilation ê 2007 FEBS 839 Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxyla...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
Báo cáo khoa học: Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis pot

Báo cáo khoa học: Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis pot

... compilation ê 2011 FEBS Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis Yasuhiro ... reactive oxygen species and apoptosis in rat primary hepatocytes. Apoptosis was accompanied by increased expression of BimEL, following...

Ngày tải lên: 06/03/2014, 00:21

9 556 0
Báo cáo khoa học: Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma ppt

Báo cáo khoa học: Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma ppt

... 2 74 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma Dorina ... 12917–12922. 24 Adams JC (20 04) Functions of the conserved thrombo- spondin carboxy-terminal cassette in cell extracellular matrix interactions and signaling...

Ngày tải lên: 07/03/2014, 05:20

13 610 0
Báo cáo khoa học: 14-3-3 Proteins regulate glycogen synthase 3b phosphorylation and inhibit cardiomyocyte hypertrophy doc

Báo cáo khoa học: 14-3-3 Proteins regulate glycogen synthase 3b phosphorylation and inhibit cardiomyocyte hypertrophy doc

... 14-3-3 Proteins regulate glycogen synthase 3b phosphorylation and inhibit cardiomyocyte hypertrophy Wenqiang Liao, Shuyi Wang, Chide Han and Youyi Zhang Institute of ... protein kinase B, PKB) at Ser473 and glycogen synthase 3b (GSK3b) at Ser9, but not extracellular signal-regulated kinase 1 ⁄ 2 (ERK1 ⁄ 2). AdR18-induced PKB and GSK3b phosphorylation was co...

Ngày tải lên: 16/03/2014, 18:20

10 290 0
Báo cáo khoa học: Increased sensitivity of glycogen synthesis to phosphorylase-a and impaired expression of the glycogen-targeting protein R6 in hepatocytes from insulin-resistant Zucker fa ⁄ fa rats pptx

Báo cáo khoa học: Increased sensitivity of glycogen synthesis to phosphorylase-a and impaired expression of the glycogen-targeting protein R6 in hepatocytes from insulin-resistant Zucker fa ⁄ fa rats pptx

... 1999 Increased sensitivity of glycogen synthesis to phosphorylase-a and impaired expression of the glycogen- targeting protein R6 in hepatocytes from insulin-resistant Zucker fa ⁄ fa rats Catherine ... curves. Higher sensitivity of glycogen synthesis to phosphorylase-a in fa ⁄ fa hepatocytes To test whether impaired...

Ngày tải lên: 30/03/2014, 11:20

11 360 0
Báo cáo khoa học nông nghiệp " Developing GAP systems for dragon fruit producers and exporters in Binh Thuan and Tien Giang provinces " pdf

Báo cáo khoa học nông nghiệp " Developing GAP systems for dragon fruit producers and exporters in Binh Thuan and Tien Giang provinces " pdf

... GAP Workshop in Binh Thuan (21-22/7/2008) 1 Developing GAP systems for dragon fruit producers and exporters in Binh Thuan and Tien Giang provinces. Nguyen Van Hoa ... Developing GAP systems for dragon fruit producers and exporters in Binh Thuan and Tien Giang provinces, which was aimed at developing quality systems...

Ngày tải lên: 21/06/2014, 05:20

10 598 0
Báo cáo khoa học: "Increased expression of osteopontin in the spinal cords of Lewis rats with experimental autoimmune neuritis" doc

Báo cáo khoa học: "Increased expression of osteopontin in the spinal cords of Lewis rats with experimental autoimmune neuritis" doc

... à m. Osteopontin in rat spinal cord with EAN 293 nerves and spinal roots. These two molecules may be involved in cell migration into the spinal cord in the early stages of EAN. Further study of the ... neurons in the spinal cord express OPN and CD44 in EAN Immunohistochemistry showed expression of OPN in some cells in the spinal cord parenchyma...

Ngày tải lên: 07/08/2014, 18:20

5 334 0
Báo cáo khoa học: "F-FDG PET/CT-based gross tumor volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value threshold and tumor parameters" pdf

Báo cáo khoa học: "F-FDG PET/CT-based gross tumor volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value threshold and tumor parameters" pdf

... al.: 18 F-FDG PET/CT-based gross tumor volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value threshold and tumor parameters. Radiation Oncology ... volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value thre...

Ngày tải lên: 09/08/2014, 09:20

8 369 0
Báo cáo khoa hoc:"A further look at quantitative trait loci affecting growth and fatness in a cross between Meishan and Large White pig populations" potx

Báo cáo khoa hoc:"A further look at quantitative trait loci affecting growth and fatness in a cross between Meishan and Large White pig populations" potx

... in a cross between Meishan and Large White pig populations Raquel Q UINTANILLA a ∗ ,DenisM ILA N b , Jean-Pierre B IDANEL a a Station de génétique quantitative et appliquée, Institut national ... with fattening batch as a fixed effect are presented; cov i is a covariate that varied according to the trait analysed: age at meas- urement for weights and ABT durin...

Ngày tải lên: 09/08/2014, 18:21

18 258 0
báo cáo khoa học: " Increased IL-10 mRNA expression in tumorassociated macrophage correlated with late stage of lung cancer" pps

báo cáo khoa học: " Increased IL-10 mRNA expression in tumorassociated macrophage correlated with late stage of lung cancer" pps

... IL-10, cathepsin B and CD68 in macrophage. A-B, High IL-10 expression in macrophage, A, IL-10 staining in macrophage (strong positivity); B, CD68 staining. C-D, Cathepsin B expression in macrophage; ... IL-10, cathepsin B and cathepsin S (Figure 2B). The mRNA expression levels of IL-10, cathepsin B and cathepsin S in TAMs The mRNA expression levels of IL...

Ngày tải lên: 10/08/2014, 10:21

9 265 0
báo cáo khoa học: " Small interference RNA targeting tissue factor inhibits human lung adenocarcinoma growth in vitro and in vivo" ppsx

báo cáo khoa học: " Small interference RNA targeting tissue factor inhibits human lung adenocarcinoma growth in vitro and in vivo" ppsx

... this article as: Xu et al.: Small interference RNA targeting tissue factor inhibits human lung adenocarcinoma growth in vitro and in vivo. Journal of Experimental & Clinical Cancer Research 2011 ... RESEARC H Open Access Small interference RNA targeting tissue factor inhibits human lung adenocarcinoma growth in vitro and in vivo...

Ngày tải lên: 10/08/2014, 10:21

11 202 0
Báo cáo khoa học: "Individually Coded Telemetry: a Tool for Studying Heart Rate and Behaviour in Reindeer Calves" ppt

Báo cáo khoa học: "Individually Coded Telemetry: a Tool for Studying Heart Rate and Behaviour in Reindeer Calves" ppt

... and reliable tool for measuring heart rate in reindeer, also in natural conditions. heart rate; measuring technique; method; individual coding; reindeer; behaviour; circadian. Acta vet. scand. 2002, ... food intake in reindeer (Rangifer tarandus tarandus). Acta Physiol. Scand. 2000, 170, 145-151. Moen AN: Seasonal changes in heart rates, activity, metabolism, and...

Ngày tải lên: 12/08/2014, 15:20

10 239 0
Báo cáo y học: " Arginase strongly impairs neuronal nitric oxide-mediated airway smooth muscle relaxation in allergic asthma" doc

Báo cáo y học: " Arginase strongly impairs neuronal nitric oxide-mediated airway smooth muscle relaxation in allergic asthma" doc

... frequencies, indi- cating that increased arginase activity strongly restricts iNANC nerve-mediated airway smooth muscle relaxation. The increased relaxation after arginase inhibition was completely reversed ... reversed by L-NNA, demonstrating that argin- ase activity attenuates iNANC nerve-mediated airway smooth muscle relaxation by limiting NO production. Since argi...

Ngày tải lên: 12/08/2014, 16:20

7 141 0
Từ khóa:
w