Period: 1 AIMS OF OBJECTIVES potx
Period: 1 AIMS OF OBJECTIVES potx
... year: 2 010 -2 011 Giaùo aùn 12 (chuaån) - 1 - GV: N Ñ P Period: 1 Date of teaching: August 22, 2 011 Class : I .AIMS OF OBJECTIVES: 1. Language content: To help sts revise the grammar of the ... comment and marks 1. Presentation of the new materials. T Q High School School year: 2 010 -2 011 Giaùo aùn 12 (chuaån) - 41 - GV: N Ñ P 1. an important part / thank...
Ngày tải lên: 27/07/2014, 10:20
AIMS OF OBJECTIVES ppsx
... High School School year: 2 010 -2 011 Giaùo aùn 12 (chuaån) - 31 - GV: N Ñ P LESSON PLAN UNIT 3: WAYS OF SOCIALISING Period: READING I. AIMS & OBJECTIVES. 1. Language Content: To ... 2 010 -2 011 Giaùo aùn 12 (chuaån) - 38 - GV: N Ñ P Date of preparation: LESSON PLAN Unit 3: WAYS OF SOCIALISING Period: WRITING Clas...
Ngày tải lên: 27/07/2014, 09:21
Central Lakes College Financial Audit For the Period July 1, 1995, through June 30, 1998 May 1999 Financial Audit Division Office of the Legislative Auditor State of Minnesota_part1 potx
... $13 ,11 3,405 $ 665,683 $ 220,890 Purchased Services 1, 865,533 238,088 948 Supplies 1, 730,8 51 276,706 25,4 21 Equipment 611 ,629 12 ,354 11 ,284 Bookstore Purchases 9 21, 153 Student Financial Aid 3, 613 ,299 Non-Mandatory ... 3, 613 ,299 Non-Mandatory Transfers 527,565 14 0,636 12 1,480 Other 2,064,227 2 81, 875 13 6,209 Total Expenditures $19 , 913 , 210 $5,228,642 $1, 437,385...
Ngày tải lên: 20/06/2014, 08:20
Period 7 UNIT 2: CLOTHING Lesson1: Getting started, Listen and read I. Aims of the lesson : By the potx
... text about the traditional dress of VN. Aks students to read the text individually * Gap fill: Asks students to read the text again to do exercises a page 14 . ? Work in pairs Gives feed ... 2. Gap fill: 1. poem, novels, and songs 2. long tunic with slits up the sides worn over loose pants 3. to wear model clothing at work 4. printing lines of poetry on it 5....
Ngày tải lên: 03/07/2014, 19:20
Period 9 UNIT 2: CLOTHING Lesson 3: Listening I. Aims of the lesson : - By the end of the lesson, potx
... 1. Pre - listening *New words: - announcement: (translation): Thông báo - missing: (synonym of lost): Thất lạc - fair: (explanation): Hội chợ - an entrance: (synonymy of a door) ... 2. Guessing. Period 9 UNIT 2: CLOTHING Lesson 3: Listening I. Aims of the lesson : - By the end of the lesson, Ss will be able to listen for specific information, describe what...
Ngày tải lên: 03/07/2014, 19:20
Giáo án tiếng anh lớp 10: Week 35 - Period 1TEST YOURSELF FI. Objectives: 1. Aims: 2. Knowledge:- Ss revise what they ppsx
... Week 35 - Period 1 TEST YOURSELF F I. Objectives: 1. Aims: - Ss revise what they have learned in Unit 15 and Unit 16 . 2. Knowledge: - General knowledge in Unit 15 and Unit 16 . - Language: ... for each part : part II: 10 minutes, part III: 10 minutes, part IV: 15 minutes. - Ask Ss to do listening in class. 2 .1. Listening: - Ask Ss to read the requirement of the task....
Ngày tải lên: 27/07/2014, 19:21
Báo cáo khoa học: Effect of priming on activation and localization of phospholipase D-1 in human neutrophils potx
... & Henson, P.M. (19 85) Modulation of multiple neutrophil functions by preparative methods or trace concentrations of bacterial lipo- polysaccharide. Am. J. Pathol. 11 9, 10 1 11 0. 17 . Henson, P.M., ... underlying mechanisms. Clin. Sci. 94, 4 61 4 71. 2. Exton, J.H. (19 98) Phospholipase D. Biochim. Biophys. Acta 14 36, 10 5 11 5. 3. Serrander, L., Fallman, M. & Stendahl, O...
Ngày tải lên: 07/03/2014, 15:20
Casa Braccio, Volumes 1 and 2 (of 2) potx
... take care of it." Dalrymple laughed at the extraordinary historical allusion compounded of the very ancient traditions of the Saracens in the south, and of the more recent wars of Napoleon. "So ... with all the ease such an undue advantage of false premise gives them. None of them have thought of intellectual mercy as being, perhaps, an integral part of Christian c...
Ngày tải lên: 17/03/2014, 13:20
UNIT 2. FORMATS FOR ELECTRONIC DOCUMENTS AND IMAGES LESSON 1. TYPES OF MARK-UP: INTRODUCTIONNOTE potx
... images - 1. Types of mark-up: Introduction - page 2 At the end of this lesson, you will able to: • understand the purpose of mark-up, and • distinguish between different kinds of mark-up. Objectives Electronic ... content of the document a set of formatting codes the description of the logical structure of a document Click on your answer In an electronic document, procedur...
Ngày tải lên: 17/03/2014, 22:20
Báo cáo khoa học: Regulation of translational efficiency by different splice variants of the Disc large 1 oncosuppressor 5¢-UTR potx
... Farmace ´ uticas, Suipacha 5 31, 2000 Rosario, Argentina Fax: +54 3 41 4390645 Tel: +54 3 41 43506 61 E-mail: gardiol@ibr.gov.ar (Received 23 January 2 011 , revised 1 May 2 011 , accepted 17 May 2 011 ) doi :10 .11 11/ j .17 42-4658.2 011 .0 818 8.x Human ... GGAAGCAAGGTGAGAGTTTAT +1 –56 +9 +73 +13 7 +2 01 5’UTR DLG Large ATG 19 116 2 43 +1 36 –27 11 G F3 +35 +54 R Exon C Exo...
Ngày tải lên: 22/03/2014, 16:20