A new bayesian classifier for skin detection

... major approaches in pixel based skin detection is using Bayesian classifiers. Bayesian classifiers performance is highly related to their training set. In this paper, we introduce a new Bayesian ... pixels in data set as an estimation of p(RGB |skin) . This is the usual approach used in Bayesian skin detection methods. For example, we can use the skin pixels data...

Ngày tải lên: 14/07/2014, 15:43

... combinations for two, three and four features resulted in statistically comparable adjusted accuracies with a radial basis classifier. In particular, the feature pairing of dispersion ratio and ... energy appears to be a useful additional feature. A radial basis network offers a versatile architecture for classifier exploration but simpler classifiers may also be suitable on th...

Ngày tải lên: 19/06/2014, 10:20

... signatures from satellite image. Therefore, the actual accuracies could be better than shown here since the accuracy was compared to SCAG land use data. Generally, Bayesian networks gave a reasonable ... coordinate values of each pixel, as inputs since geospatial ancillary data improves accuracy (Park and Stenstrom, 2003). We classified stormwater pollutant loadings using Bayesian...

Ngày tải lên: 05/09/2013, 09:08

... is not an enduring personality trait that is generalizable acrosssituations. Rather, it is a relatively stable psychologicalstate. In terms of temporalstability (i.e, malleability), variance in ... the new scale, and data collection and analysisfrom a replication sample. PHASE 1: CONSTRUCT DEFINITION AND VALIDATION Although Kahn’s(1990)seminal work explored “discrete moments” of engage...

Ngày tải lên: 07/09/2013, 11:05

... these cases as repairs, as well as to distinguish them from nonfrag- ment repairs. Thus, pausal duration may serve as a general acoustic cue for repair detection, particularly for the class ... glottalization. 5 Although interruption glottalization is usually associated with fragments, not all fragments are glottalized. In our database, 62% of fragments are not glottalized, and...

Ngày tải lên: 20/02/2014, 21:20

... cornerstone of Australian manufacturing. A New Car Plan for a Greener Future is a plan for reinventing the Australian car industry. It is about preparing the industry for a low-carbon future and making ... future of manufacturing in Australia. Manufacturing employs a million Australians and accounts for a tenth of our GDP. We can’t have a balanced economy without...

Ngày tải lên: 07/03/2014, 11:20

... (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAAT GCGGCCGCTCAGTCCTGCTC ... the 3¢-UTR, a PCR was performed using Pnr ⁄ BamHI5.4kb as the template with sense primer 5¢-GAAT GCGGCCGCGA ATGTGTGCAAATTGAAGAAC-3¢ and antisense primer 5¢-TTCGAGCTCCGGGGAAACGGTGC...

Ngày tải lên: 07/03/2014, 21:20

... but A. laterale possessing that allele must be present in that population because it appears in tetraploids from egg masses S2 and S7 (Table 3) as a male A. laterale– derived additional allele ... labelled with tetramethyl rhodamine. DNA was amplified with standard PCRs for microsatellite DNA. The annealing temperature was optimized at 57 8C for loci AjeD94, AjeD346, and AjeD422, and...

Ngày tải lên: 14/03/2014, 16:20

... Development and Function in Cephalopods 71 TABLE 1. A general scale of maturity stages for male and female cephalopods. (AG = accessory glands, oviducal glands, NG = nidamental glands, SG = spermatophoric gland, SP ... are usually dull white. Gonad has semi- transparent dull-white lamina. Oocytes are simple follicles. Gonad is large, opaque and appear granular. Oocytes are at intercalary...

Ngày tải lên: 14/03/2014, 16:20

... 1988; Parasuraman, Zeithaml, and Berry 1988) •Value and supply chain management (Normann and Ramirez 1993; Srivastava, Shervani, and Fahey 1999) •Resource management (Constantin and Lusch 1994; Day ... that “an alternative paradigm of marketing is needed, a paradigm that can account for the continuous nature of relationships among marketing actors.” They went as far as stating (p. 140) th...

Ngày tải lên: 15/03/2014, 22:20