... provides practical information with reasonable accuracy, which can be used for environmental planning and management Open land use corresponds to low pollutant loads for all water quality parameters ... loading areas, which were classified as public land use in the SCAG data and USGS classification system Recreational facilities including parks were also classified as low pollutant loading areas, ... pollutant loads per unit pixel and unit rainfall for each water quality parameter i and α is a normalization factor that depends on units and conversion factors Table Runoff coefficient and EMCs for...
Ngày tải lên: 05/09/2013, 09:08
... bishrink filter with global estimation of local variance, for the forth iteration it acts as a local adaptive Wiener filter and for the fifth iteration (the last one) it acts as a hard thresholding filter, ... International Conference on Acoustics, Speech and Signal Processing (ICASSP ’01), Salt Lake City, Utah, USA, May 2001 [23] S Moga and A Isar, “SONAR image denoising using a Bayesian approach in the wavelet ... not make a local estimation, was considered for the treatment of the Lena image in Table The second implementation makes a local estimation and has better performance It was considered for the...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo sinh học: "he water flea Daphnia - a ‘new’ model system for ecology and evolution" potx
... comparative analysis of neural characters in higher crustaceans (malacostracans) and insects For example, in both insects and malacostracans, stem-cell-like neuroblasts have been detected that ... of Daphnia The study of parasites (viruses, bacteria and multicellular parasites) has also gained momentum as a result of their influence on Daphnia ecology and evolution [3] Parasites can directly ... populations Genetic variation has been reported in Daphnia for a vast number of traits such as size, aging, Page of behavior (for example, vertical migration, fish-escape behavior), morphology (for...
Ngày tải lên: 06/08/2014, 19:21
Báo cáo y học: " A new miniaturized system for extracorporeal membrane oxygenation in adult respiratory failure" potx
... of bleeding and older age, which had been traditionally contraindications for ECMO therapy A fast and sustained rise in PaO2/FiO2 as well as a rapid decrease in PaCO2 and normalization of pH ... of data and drafted the manuscript AP, AL, CK, TB, LR, JL and ML have made substantial contributions to treatment of patients, acquisition of data, interpretation of data and revised the manuscript ... critically JW has made substantial contribution to acquisition of data and analysis of data MH, MZ, MA, CS, GR and MP have made substantial contribution to conception and design and interpretation...
Ngày tải lên: 13/08/2014, 20:21
Tài liệu A New Banking System The Needful Capital for Rebuilding the Burnt District docx
... furnishing an amount of loanable capital more than twelve times as great as that of all the "National" Banks in the State[C]; more than twice as great as that of all the "National" banks of the ... equal, on an average, to the capital of the present "National" banks That is, this system is capable of furnishing fifty-six times as many banks as the "National" system, having each the same capital, ... more cheaply than Massachusetts can manufacture for them Their natural advantages for manufacturing are greatly superior to those of Massachusetts They have the cheap food, coal, iron, lead, copper,...
Ngày tải lên: 17/02/2014, 18:20
Reproductive System Structure, Development and Function in Cephalopods with a New General Scale for Maturity Stages pot
... and appear granular Oocytes are at intercalary and protoplasmic growth phase AG are completely formed and usually white Gonad is large, usually dullwhite Spermatozoa accumulate in testis ampullae ... Octopoteuthis sicula, Sepia bertheloti and Abraliopsis atlantica In Argonauta argo and Pteriqioteutnis gemmata, at the stage when the simple follicle nucleoli start decomposing, they acquire a characteristic ... sicula and Sepiel /a ornata (our data) Stage III The gonad is maturing and accessory glands become fully formed The gonad is large In the ovary granular structures are clearly visible Three substages...
Ngày tải lên: 14/03/2014, 16:20
Báo cáo sinh học: "Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" doc
... Sugiyama A, Kume H, Ota S, Kashima T, Tomita K, Kitamura T, Kodama T, Fukayama M, Aburatani H: Identification of Toll-like receptor as a potential therapeutic target in clear cell renal cell carcinoma ... dissolve the MTT-formazan crystals The absorbance was measured at 490 nm by an ELISA microplate reader (Bio-Rad) Besides that, the toxicity on Ana-1 and HUVEC cells were evaluated with the same method ... physic-chemical properties (size and charge) of each separate material, including PCFC-g-PEI and FA-PEAs, as well as the FA-PEAs: pVHL complexes Because PCFC-g-PEI and FA-PEAs are amphiphilic...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" pot
... Sugiyama A, Kume H, Ota S, Kashima T, Tomita K, Kitamura T, Kodama T, Fukayama M, Aburatani H: Identification of Toll-like receptor as a potential therapeutic target in clear cell renal cell carcinoma ... dissolve the MTT-formazan crystals The absorbance was measured at 490 nm by an ELISA microplate reader (Bio-Rad) Besides that, the toxicity on Ana-1 and HUVEC cells were evaluated with the same method ... physic-chemical properties (size and charge) of each separate material, including PCFC-g-PEI and FA-PEAs, as well as the FA-PEAs: pVHL complexes Because PCFC-g-PEI and FA-PEAs are amphiphilic...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo hóa học: " Research Article Strong Convergence Theorem for a New General System of Variational Inequalities in Banach Spaces" pdf
... Yao, M A Noor, K Inayat Noor, Y.-C Liou, and H Yaqoob, “Modified extragradient methods for a system of variational inequalities in Banach spaces,” Acta Applicandae Mathematicae, vol 110, no 3, ... classical variational inequality VI C, A In 2006, Aoyama et al first considered the following generalized variational inequality problem in Banach spaces Let A : C → X be an accretive operator ... A3 problem 1.10 in a real Hilbert space Second, we introduce iteration process for finding a solution of a new general system of variational inequalities in a real Banach space Starting with arbitrary...
Ngày tải lên: 21/06/2014, 07:20
Báo cáo hóa học: " Research Article A New Hybrid Algorithm for a System of Mixed Equilibrium Problems, Fixed Point Problems for Nonexpansive Semigroup, and Variational Inclusion Problem" ppt
... problem and variational inequality problem,” Fixed Point Theory and Applications, vol 2010, Article ID 383740, 19 pages, 2010 11 P Cholamjiak and S Suantai, A new hybrid algorithm for variational ... spaces,” Journal of Mathematical Analysis and Applications, vol 341, no 1, pp 276–286, 2008 23 S Takahashi and W Takahashi, “Strong convergence theorem for a generalized equilibrium problem and ... Theory and Applications T Jitpeera and P Kumam, “An extra gradient type method for a system of equilibrium problems, variational inequality problems and fixed points of finitely many nonexpansive mappings,”...
Ngày tải lên: 21/06/2014, 07:20
Báo cáo sinh học: " A new plasmid vector for DNA delivery using lactococci" pptx
... ATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAGCTTAAGCTTGGTACCGA BamHI EcoRI PstI EcoRV NotI XhoI GCTCGGATCCGGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTC XbaI ApaI GAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGT ... KpnI AflII NheI ApaI XbaI BsiEI NotI EcoRV PstI EcoRI ClaI polyA MCS Rep C pCMV pValac BglII 3742 bp Rep A Cm T7 promoter/priming site B NheI AflII KpnI ATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAGCTTAAGCTTGGTACCGA ... GAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGT TTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGA polyA Figure Structure of pValac plasmid Structure of pValac plasmid A: Boxes indicate: Multiple...
Ngày tải lên: 14/08/2014, 19:22
A Fast File System for UNIX
... insufficient space to hold the new data) If space exists in a block already allocated, the space is filled with new data If the remainder of the new data contains more than a full block of data, a full ... fragments and a single unused fragment This remaining fragment can be allocated to another file as needed Space is allocated to a file when a program does a write system call Each time data is written ... the allocated space The problem with expanding a file one fragment at a a time is that data may be copied many times as a fragmented block expands to a full block Fragment reallocation can be minimized...
Ngày tải lên: 12/09/2012, 14:16
A web-based system for notifying environment violation.doc
... Geographic Information system (GIS) is any system integrates hardware, software, and data for capturing, managing, analyzing, and displaying all forms of geographically referenced information ... operating system - Easy to manage, update database: Database is located at dedicated server that managers can maintain and update it easily - Quick delivery: web-based model make it portable to ... 2.3.2.3 Data access tier It consists of the database server that contains all logic data of application Separating logic data from application into it will make program scalable and higher performance...
Ngày tải lên: 27/10/2012, 16:40
a new measurement scale for employee engagement
... enduring personality trait that is generalizable acrosssituations Rather, it is a relatively stable psychologicalstate In terms of temporalstability (i.e, malleability), variance in individual levels ... observations were used for EFA, and the remaining 266 observations composed the CFA sample Exploratory Factor Analysis(EFA) EFA was conducted in SPSS using Principal Axis Factoring with Varimax ... demographic characteristic were examined forsignificant associations Previous engagement research reportsthat engagement levels are higherforsupervisors and managers than for employees at lowerlevels...
Ngày tải lên: 07/09/2013, 11:05
Tài liệu A Knowledge Management System for ERP Implementation pdf
... cooperative working platform, knowledge transfer platform, individual RESEARCH PAPER KM platform, organizational KM platform and consulting platform The interplay of these five platforms can speed ... Lastly, a KM system is proposed that consists of cooperative working platform, consulting platform, individual KM platform, organizational KM platform, and knowledge transfer platform This system ... (2006) Yuan Li et al Syst Res RESEARCH PAPER Cooperative Working Platform Individual Organizational KM Consulting Platform Platform KM Platform Knowledge Transfer Platform Figure The platform structure...
Ngày tải lên: 16/01/2014, 16:33
Tài liệu Báo cáo khoa học: "GEMINI: A NATURAL LANGUAGE SYSTEM FOR SPOKEN-LANGUAGE UNDERSTANDING*" doc
... is that when they are formulated loosely, as in the previous paragraph, they appear to conflict In particular, in ( 2a) , Right Association seems to call for the parse that makes for Mary a modifier ... Systems, ed P Jacobs, Lawrence Erlbaum Associates, Hillsdale, NJ, pp 13-33 Kameyama, M (1992) "The Syntax and Semantics of the Japanese Language Engine", forthcoming In Mazuka, R., and N Nagai, ... the fact that every lexical item has a semantics associated with it Table contains average edge counts and parse timing statistics for the 5875-utterance training set Many systems (Carbonell and...
Ngày tải lên: 20/02/2014, 21:20
A NEW CAR PLAN FOR A GREENER FUTURE doc
... future of manufacturing in Australia Manufacturing employs a million Australians and accounts for a tenth of our GDP We can’t have a balanced economy without it – and we can’t have a just society ... things as well That’s why the automotive sector is a cornerstone of Australian manufacturing A New Car Plan for a Greener Future is a plan for reinventing the Australian car industry It is about ... It is about mutual obligation all round – a genuine partnership The new car plan acknowledges that all Australians benefit from having a healthy automotive industry, that everyone has a stake in...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx
... Biosciences, Columbia, MD, USA) with sense primer SOE-3 (5¢-AAAAATCA ACGCTGAACAATGGTGAGCAAAGGGCGAG-3¢) and antisense primer SOE-4 (5¢-GAATGCGGCCGCTTACT TGTAACAGCTCGTCCATG-3¢), which introduced a NotI site ... (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAATGCGGCCGCTCAGTCCTGCTCCTCGGCCAC-3¢, ... 165-bp fragment of the fcp 5¢-UTR was amplified by PCR from pUC18 ⁄ fcp1.9kb using the sense primer 5¢-GAT CTTTGCTACGTACGAACG-3¢ and the antisense primer 5¢-GCTCTAGAGATATCTAGTCTTTGTGATAAAGAAA ATTATG-3¢...
Ngày tải lên: 07/03/2014, 21:20
UNISEXUAL SALAMANDERS (GENUS AMBYSTOMA) PRESENT A NEW REPRODUCTIVE MODE FOR EUKARYOTES doc
... genomotype A barbouri A barbouri A barbouri A barbouri A barbouri A barbouri A jeffersonianum A jeffersonianum A jeffersonianum A laterale A laterale A laterale A maculatum A maculatum A texanum A texanum ... inheritance in unisexual salamanders All known unisexuals have at least A laterale genome (Bogart 2003) Therefore, we expected to find a common pattern for A laterale microsatellite DNA alleles that ... 1995) A similar pattern was found by Zamudio and Savage (2003) in a widespread clade of A maculatum in the northeastern United States and Canada The known range of unisexual populations of Ambystoma...
Ngày tải lên: 14/03/2014, 16:20