the balance of payments as a monetary phenomenon

the balance of payments as a monetary phenomenon

the balance of payments as a monetary phenomenon

... balance of payments situations. The main aim of this paper is to examine the monetary approach to the balance of payments (MABP), which argues that the balance of payments is a monetary phenomenon . ... monetary approach to the balance of payments. Journal of economic issues, 24(2):433–441. [19] Leon, H. 1988. A monetary approach to the b...

Ngày tải lên: 13/07/2014, 21:13

12 483 1
Tài liệu The Man of Letters as a Man of Business docx

Tài liệu The Man of Letters as a Man of Business docx

... that there is always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with the ... is the case of authorship as it now stands with regard to the magazines. I am not sure that the case is in every way improved for young authors. The magazines all maintain a...

Ngày tải lên: 17/02/2014, 19:20

21 544 0
The Project Gutenberg EBook of The Man of Letters as a Man of Business, by William Dean Howells potx

The Project Gutenberg EBook of The Man of Letters as a Man of Business, by William Dean Howells potx

... because they have the affair altogether in their hands they are apt to take advantage in it; but this does not follow, and as a matter of fact they have the affair no more in their own hands than any ... best in them awaits its resurrection in the book, which, as the first form, is so often a lasting death. An interesting proof of the value of the magazine to literat...

Ngày tải lên: 28/06/2014, 17:21

126 362 0
The Project Gutenberg EBook of The Man of Letters as a Man of Business by William Dean Howells pptx

The Project Gutenberg EBook of The Man of Letters as a Man of Business by William Dean Howells pptx

... writing of him as an Artist. Besides, as an artist he has been done a great deal already; and a commercial state like ours has really more concern in him as a business man. Perhaps it may sometime ... at Oxford made an American collegian say in a theme which they imagined for him in his national parlance; and the man of letters, as an artist, is apt to have times and sea...

Ngày tải lên: 28/06/2014, 17:21

130 318 0
Tài liệu Interest on Excess Reserves as a Monetary Policy Instrument: The Experience of Foreign Central Banks ppt

Tài liệu Interest on Excess Reserves as a Monetary Policy Instrument: The Experience of Foreign Central Banks ppt

... Reserve Bank of Australia, the Bank of Canada, the Bank of England, the European Central Bank, the Bank of Japan, the Reserve Bank of New Zealand, Norges Bank, and the Riksbank. Each case study reviews ... of Monetary Affairs) and Spence Hilton (Federal Reserve Bank of New York), as well as from central bank colleagues at the Reserve Bank of Australia,...

Ngày tải lên: 17/02/2014, 03:20

49 653 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

... autoradiographed. Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢;NF1mut,5¢-TTTT GGATTGAATAAAATATGATA-3¢;Site-2wt,5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢;Site-2mut,5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢;Site-3wt, 5¢-GGGTTCTTTTGGCATCCCTGTAGC-3¢;Site-3mut, 5¢-GGGTTCTTTTTAAATCCCTGTAGC-3¢. Chromatin ... [13]. Site-2 and Site-3 binding ac...

Ngày tải lên: 07/03/2014, 15:20

8 426 0
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc

Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc

... Rac2 and S10 0A9 . Assay of NADPH oxidase activity after oxidase activation The dormant NADPH oxidase of neutrophil membranes was activated by mixing neutrophil plasma membranes and the recombinant cytosolic ... GTPcS-loaded Rac2, MgSO 4 and an optimal amount of arachidonic acid determined for each assay of oxidase activation [12]. The rate of O 2 – production by the activat...

Ngày tải lên: 18/03/2014, 01:20

10 396 0
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx

Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx

... information to Professor Andrzej Granas.) This result is a discrete analog of the Banach contraction principle (BCP) and it has applications in automata theory. Theorem 1.1 (Eilenberg). Let X be an ... y), and therefore, each non- Archimedean metric space has the extraordinary geometric property that each three points of it are vertices of an isosceles triangle. We notice that non...

Ngày tải lên: 23/06/2014, 00:20

6 268 0
Báo cáo y học: "The characterisation of mucin in a mature ovarian teratoma occurring in an eight year old patient

Báo cáo y học: "The characterisation of mucin in a mature ovarian teratoma occurring in an eight year old patient

... a normal or dis- eased state. As far as we know this is the first time an amino acid analysis has been done of purified mucin in an ovarian teratoma. The observation that this ovarian teratoma ... normal glandular epithelial cells and dramatically increased in malignant cells of the breast, ovary and pancreas [15]. Mucin genes are independently regulated and their expres...

Ngày tải lên: 26/10/2012, 10:03

9 549 0
w