MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 1 ppt
Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"
... permanent radioactive implants (brachytherapy) [7]. iv) The standard initial systemic therapy for locally advanced or metastatic disease is hormonal or androgen depri-vation therapy (ADT) that ... Targeting uPA/uPAR in prostate cancer. Cancer Treat. Rev. 2007;33(6):521-7 3. Catalona WJ and Smith DS. 5-year tumor recurrence rates after anatomical radical retropubic prostatectomy for prostate ... Publisher. All rights reserved Research Paper High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ- BioShuttle Treatment Klaus Braun1...
- 10
- 408
- 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"
... Review Rasburicase represents a new tool for hyperuricemia in tumor lysis syn-drome and in gout Lisa Cammalleri and Mariano Malaguarnera Dept of Senescence, Urological and Neurological Sciences, ... monophosphate (GMP), the purinic nucleotides useful for DNA and RNA synthesis, and inosine that will be degraded into hypoxanthine and xanthine and finally into uric acid. Hypoxanthine and guanine ... it may cause. A rapid and massive raise of uric acid, during tumor lysis syn-drome (TLS), and also a lower and chronic hyperuricemia, as in gout, mainly damage the kidney. To prevent or treat...
- 11
- 715
- 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
... session than in the first one,whereas the pleasantness of the heightened aroma sampleincreased in the second tasting session compared with the first one (interaction of age group and aroma and tasting,Fð1; ... The pleasantness of the heightened aromasample increased during the home-use, while the pleasantness of the regular aroma sample remainedvirtually unchanged (interaction of aroma and day,Fð2; ... right after opening the lid, and the pleasantness and flavor intensity after tasting 3–4spoonfuls of the sample. The scales used were the same as in the tasting sessions. Subjects were also asked...
- 10
- 599
- 1
Tài liệu Fourier and Spectral Applications part 1 ppt
... 538Chapter 13 . Fourier and Spectral Applications Sample page from NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-5 21- 4 310 8-5)Copyright (C) 19 88 -19 92 by Cambridge University ... copied into channel j − 1; and so on forboth positive and negative values of k in rk. Figure 13 .1. 2 illustrates the situation.Example: a response function with r0= 1and all other rk’s equal ... the response function with r 14 =1. 5and all other rk’s equal to zero. This produces convolved output that is the input signalmultiplied by 1. 5 and delayed by 14 sample intervals.Evidently,...
- 2
- 341
- 0
Tài liệu FLUID-STRUCTURE INTERACTIONSSLENDER STRUCTURES AND AXIAL FLOW VOLUME 1 ppt
... 2.0 18 4 2. 016 6 2. 016 4 2. 016 3 2. 016 3 R2(El/m L4)-’I2 17 .16 6 16 .936 16 . 912 16 .906 16 .904 R3(El/m L4)-‘I2 - 52. I25 5 1. 826 5 1. 754 5 1. 738 CONCEPTS, DEFINITIONS AND METHODS 11 eigenvectors ... 302 303 314 315 316 316 317 327 328 328 333 336 348 348 348 366 368 387 392 394 394 402 412 413 415 415 417 417 4 21 426 426 428 429 430 4 31 436 437 438 440 ... rather than positive definite. FLUID-STRUCTURE INTERACTIONS SLENDER STRUCTURES AND AXIAL FLOW VOLUME 1 CONTENTS VI 11 5.5 Pipes with supported ends 5.5 .1 The effect of amplitude on...
- 598
- 404
- 2
modeling with data tools and techniques for scientific computing oct 2008
... sequence and the ratio of the nth over the (n−1)st element for eachn.gsl_stats July 10, 2008 gsl_stats July 10, 2008 Modeling with Data gsl_stats July 10, 2008 I COMPUTING gsl_stats July 10, 2008 gsl_stats ... arriveat writing a book on data- oriented computing using a general and basic computing language. For the purpose of modeling with data, I have found C to be an easier and more pleasant language ... thestackofframes• Programming tools like the debugger and profiler• Methods for reliability testing functions and making them more robust• Databases, and how to get them to produce data in the format you need•...
- 471
- 450
- 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... GTGTTCGACTTTGCCAGCCTGTACCCCAGCATCATCCAGGCCCACAACCTGTGC VZV GTATTGGATTTTGCAAGTTTATATCCAAGTATAATTCAGGCCCATAACTTATGT HHV6 GTGTTTGATTTTCAAAGTTTGTATCCGAGCATTATGATGGCGCATAATCTGTGT CMV GTGTTCGACTTTGCCAGCCTCTACCCTTCCATCATCATGGCCCACAACCTCTGC ... GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC EHV2 GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC MHV68 GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT AH1 GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... GTTTTTGATTTCCAAAGTTTGTATCCAAGTATTATGATGGCTCATAATCTGTGT RhCMV GTGTTTGACTTTGCCAGCCTGTATCCGTCAATTATCATGGCACATAATCTCTGT RFHVMm GTTGTGGATTTTGCTAGCCTTTATCCCAGCATCATGCAGGCCCACAACCTATGT AtHV3 GTAGTAGACTTTGCTAGCCTTTACCCAAGTATTATACAAGCTCATAATCTGTGT...
- 24
- 604
- 0
MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 1 ppt
... Jacques Fanjason Ramahaleomiarantsoa, Eric Jean Roy Sambatra, Nicolas Héraud and Jean Marie Razafimahenina Chapter 5 Dynamic and Quasi-Static Simulation of a Novel Compliant MEMS Force Amplifier ... MATLAB – A Fundamental Tool for Scientific Computing and Engineering Applications – Volume 1 12 for i =1: Tam, if output(i) < 1 IAE_Value = IAE_Value + (1- output(i))*int_T; ... systems: MATLAB – A Fundamental Tool for Scientific Computing and Engineering Applications – Volume 1 22 Note: It may be necessary to convert data to suitable matrix form (e.g. rough data are in...
- 534
- 691
- 0
MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 2 potx
... Using MATLAB/ SIMULINK Software 26 3 Qutaiba I. Ali Chapter 13 Semi-Analytic Techniques for Fast MATLAB Simulations 28 5 Daniele Borio and Eduardo Cano MATLAB – A Fundamental Tool for Scientific ... Induction Machines 139 Moulay Tahar Lamchich and Nora Lachguer MATLAB – A Fundamental Tool for Scientific Computing and Engineering Applications – Volume 2 34 The path loss verses base stations ... hroof MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 2 Edited by Vasilios N. Katsikis MATLAB COM Integration for Engineering Applications...
- 324
- 788
- 0
A textbook of Computer Based Numerical and Statiscal Techniques part 1 ppt
... This pageintentionally leftblankThis pageintentionally leftblank A TEXTBOOK OF COMPUTER BASED NUMERICAL AND STATISTICAL TECHNIQUES Anju Khandelwal M.Sc., Ph.D.Department of MathematicsSRMS ... Based Numerical and Statistical Techniques is primarily writtenaccording to the unified syllabus of Mathematics for B. Tech. II year and M.C .A. I year students of all Engineering colleges affiliated ... WORLDNEW AGE INTERNATIONAL (P) LIMITED, PUBLISHERS4835/24, Ansari Road, Daryaganj, New Delhi - 11 0002Visit us at www.newagepublishers.comISBN (13 ) : 978- 81- 224-28 81- 0PrefaceThe present book ‘Computer...
- 10
- 425
- 1
DEFINITIONS CONVERSIONS and CALCULATIONS for OCCUPATIONAL SAFETY and HEALTH PROFESSIONALS - CHAPTER 1 ppt
... Multiplierdeca- da 10 1 deci- d 10 1 hecto- h 10 2centi- c 10 –2kilo- k 10 3milli- m 10 –3mega- M 10 6micro- µ 10 –6giga- G 10 9nano- n 10 –9tera- T 10 12 pico- p 10 12 peta- P 10 15 femto- f 10 15 exa- ... #1. 1 Problem #1. 2 Problem #1. 3 Problem #1. 4 Problem #1. 5 Problem #1. 6 Problem #1. 7 Problem #1. 8 Problem #1. 9 Problem #1. 10 Problem #1. 11 Problem #1. 12 Problem #1. 13 Problem #1. 14 ... Equation # 2-3 Problem #2.3: Application of Equation # 2-4 Problem #2.4: Application of Equation #s 1- 1 , 1- 3 , & 2-5 Problem #2.5: Application of Equation #s 1- 1 , 1- 9 , 1- 1 0, 1- 1 6, & 2-5 SOLUTIONS...
- 87
- 575
- 0
báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt
... program that packages information on the design and evaluation of evidence-based QI interventions into an integrated, easily accessible, and practical tool. In this paper, we provide a general ... relevant clinicalpractice guidelines (Clinical Practice Guidelines). It alsodiscusses the why, what and how of measuring baselineperformance defined as the measurement of actual clini-cal practice ... development The target audience of the tool include QI researchers,healthcare professionals and managers responsible for developing, delivering and evaluating continuing educa-tion (CE) and QI programmes...
- 7
- 429
- 0
Materials Science and Engineering Handbook Part 1 pptx
... 48 .18 Cadmium 10 6 1. 22 10 8 0.88 11 0 12 .39 11 1 12 .75 11 2 24.07 11 3 12 .26 11 4 28.86 11 6 7.58Indium 11 3 4.28 11 5 95.72Tin 11 2 0.96 11 4 0.66 11 5 0.35 11 6 14 .30 11 7 7. 61 118 24.03 11 9 8.58 12 0 32.85 12 2 4.72 12 4 ... 0 .13 6 16 4 1. 56 16 6 33. 41 167 22.94 16 8 27.07 17 0 14 .88 18 6 1. 59Thulium 16 9 10 0.0 18 9 16 .1 Ytterbium 16 8 0 .13 5 17 0 3.03 17 1 14 . 31 172 21. 82 17 3 16 .13 17 4 31. 84 17 6 12 .73Lutetium 17 5 97.40 17 6j2.60Table ... 0. 012 18 1 99.988Tungsten 18 0 0 .14 18 2 26. 41 183 14 .40 18 4 30.64Rhenium 18 5 37.07 18 7 62.93Osmium 18 4 0. 018 18 7 1. 64 18 8 13 .3 19 0 26.4 19 2 41. 0Iridium 19 1 37.3 19 3 62.7Platinum 19 0m0. 013 19 2...
- 85
- 402
- 0
Từ khóa: cpc as a new tool for preparative scale purification of lipid and related compoundscreating a text tool for dialogs and captionsmsdetotext tool for internet security and acceleration isa server 20061 choose the right tool for model export and importraman spectroscopy as a characterization tool for carbon materialsa learning environment for both experts and novicesnurses perceptions of using a pocket pc for shift reports and patient carea software tool for reading dicom directory fileschildren apos s contributions to designing a communication tool for children with cancerecosystem health a flawed basis for federal regulation and land use managementdevelopment of a terrestrial index of ecological integrity tiei a new tool for ecosystem managementvalue of a statistical case for three illnesses and different cessation lagstoward disaster resilient communities a new approach for south asia and africaestablishing a maintenance program for plant efficiency and energy savingsthe on line coupled mesoscale climate chemistry model mccm a modelling tool for short episodes as well as for climate periodsNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ