0

towards a universal platform for scientific and statistical computing

báo cáo sinh học:

báo cáo sinh học:" Call for manuscripts: "Towards a scaling-up of training and education for health workers" ppt

Điện - Điện tử

... from, and complement, traditional community health worker training? • How can the health professional training be better aligned with local health needs and be more socially accountable? • What ... developed and tested for customizing the workforce skill mix to local health service needs? For example, what impact have recent health sector reforms had on the local health workforce? • What is ... the status of existing collaborations between developing countries aiming to improve health worker education? • How have modifications in healthcare management had an impact upon health workforce...
  • 2
  • 415
  • 0
báo cáo sinh học:

báo cáo sinh học:" Final call for papers: "Towards a scaling-up of training and education for health workers" potx

Điện - Điện tử

... principally from inadequate educational opportunities for health workers and a lack of relevance of their training to community health care practice Additional contributing factors include: inadequate ... modifications in healthcare management had an impact upon health workforce capacity at the local level? Papers will be accepted in two formats: Brief communications of less than 1200 words: better ... inadequate compensation and working conditions, the deteriorating health of the workforce in many developing countries, urban/rural and workforce imbalance, and migration of the workforce from developing...
  • 2
  • 370
  • 0
MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 1 ppt

MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 1 ppt

Kỹ thuật lập trình

... Fanjason Ramahaleomiarantsoa, Eric Jean Roy Sambatra, Nicolas Hộraud and Jean Marie Razafimahenina Chapter Dynamic and Quasi-Static Simulation of a Novel Compliant MEMS Force Amplifier by Matlab/Simulink ... Balogh, Pavel Zỏskalický, S Chountasis, V.N Katsikis, D Pappas, Mohammed Z Al-Faiz, Abbas H Miry, Ramy Saad, Sebastian Hoyos, Samuel Palermo, Momoh-Jimoh E Salami, Ismaila B Tijani, Abdussamad ... Transformer Using Matlab 219 Adel Aktaibi and M Azizur Rahman Chapter 11 PH Control Using MATLAB 243 Mostefa Ghassoul Chapter 12 An Advanced Transmission Line and Cable Model in Matlab for the...
  • 534
  • 691
  • 0
MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 2 potx

MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 2 potx

Kỹ thuật lập trình

... Prokop, Walid Hassairi, Moncef Bousselmi, Mohamed Abid, Carlos Valderrama, Moulay Tahar Lamchich, Nora Lachguer, Gaizka Almandoz, Gaizka Ugalde, Javier Poza, Ana Julia Escalada, Oriol Font-Bach, Antonio ... Software for Design and Analysis of Electrical Machines 161 Gaizka Almandoz, Gaizka Ugalde, Javier Poza and Ana Julia Escalada Section Telecommunication-Communication Systems 185 Chapter MATLAB as ... in Matlab: Issues and Impairments 217 Bahman Azarbad and Aduwati Binti Sali Chapter 11 Wireless Channel Model with Markov Chains Using MATLAB 235 Diana Alejandra Sánchez-Salas, José Luis Cuevas-Ruíz...
  • 324
  • 788
  • 0
Báo cáo y học:

Báo cáo y học: " XGAP: a uniform and extensible data model and software platform for genotype and phenotype experiments" potx

Báo cáo khoa học

... research aims The XGAP data format can be used to represent and exchange all raw, intermediate and result data associated with an investigation, and an XGAP database, for instance, can be used as a platform ... file format to exchange data using this model (XGAP-TAB) and easy-to-customize database software (XGAP-DB) that will help groups to directly use and adapt XGAP as a platform for their particular ... Data, and DataElement For example: a single-channel microarray reports raw gene expression Data for each microarray probe Trait and each individual Subject Add information on data provenance by...
  • 15
  • 400
  • 0
báo cáo khoa học:

báo cáo khoa học: " A Viral Platform for Chemical Modification and Multivalent Display" pdf

Báo cáo khoa học

... introduced and propagated This is an advantage not readily available in some other systems Moreover, cDNA clones of viral RNA are infectious, making it easy to produce viable recombinant viruses that ... Virus Particles as Templates for Materials Synthesis Adv Mater 1999, 11:679-681 Douglas T, Strable E, Willits D, Aitouchen A, Libera M and Young M: Protein Engineering of a Viral Cage for Constrained ... for Genetic Analysis of a Protein-RNA Interaction J Biol Chem 1990, 265:5684-5689 Peabody DS and Al-Bitar L: Isolation of Viral Coat Protein Mutants With Altered Assembly and Aggregation Properties...
  • 8
  • 326
  • 0
Báo cáo y học:

Báo cáo y học: "A comprehensive platform for quality control of botanical drugs (PhytomicsQC): a case study of Huangqin Tang (HQT) and PHY906" potx

Báo cáo khoa học

... define and validate the quality control metric and to help set batch acceptance criteria Information-rich patterns are analyzed and compared with an established, well-characterized batch used for ... methods for both chemical and biological characterization While the traditional chemical analysis of standard marker compounds provides a useful quantitative mass balance, patterns of information-rich ... the National Cancer Institute (NCI) (CA-63477) of the National Institute of Health USA and the National Foundation for Cancer Research We also acknowledge that a small subset of the data and descriptions...
  • 15
  • 303
  • 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Báo cáo khoa học

... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared ... guidelines and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA ... enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, and 200 lm each of dATP, dCTP, dGTP and dTTP The product was separated from...
  • 16
  • 691
  • 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Báo cáo khoa học

... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
  • 11
  • 873
  • 0
Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf

Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf

Tiếp thị - Bán hàng

... Specialty Product A B C D Mass Market Niche Market F Bibliography Essel, A E 1993 Niche marketing—An alternative for small and part-time farmers Farm Management Update Blacksburg, VA: Virginia Tech ... Graduate Research Assistant Department of Wood Science and Forest Products Virginia Polytechnic Institute and State University Blacksburg, VA Published by: Northeastern Area State and Private Forestry ... instead They were transformed into marketing managers, marketing engineers and marketing associates, and some even became marketing representatives.” —Lamont C Blake Marketing Consultant As can...
  • 92
  • 2,180
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Outilex, a Linguistic Platform for Text Processing" pdf

Báo cáo khoa học

... fundamental operations for text processing: processing without lexicon, lexicon and grammar exploitation and LR management Data are structured both in standard XML formats and in more compact ones Format ... Poznan, Poland, pages 90–94 Javier M Sastre 2005 XML-based representation formats of local grammars for NLP In Proc of the Language and Technology Conference, Poznan, Poland, pages 314–317 Hamish ... Mehryar Mohri, Fernando Pereira, and Michael Riley 1998 A rational design for a weighted finite-state transducer library Lecture Notes in Computer Science, 1436 References Takuya Nakamura 2005 Analysing...
  • 4
  • 428
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Writing Assistant for CAT and CALL" pdf

Báo cáo khoa học

... Proceedings of ACL Y Ma, N Stroppa, and A Way 2007 Bootstrapping word alignment via word packing In Proceedings of ACL L Nepveu, G Lapalme, P Langlais, and G Foster 2004 Adaptive language and translation ... train TransAhead, we used British National Corpus and Hong Kong Parallel Text and deployed GENIA tagger for POS analyses To evaluate TransAhead in CAT and CALL, we introduced it to a class of 34 ... interactivity made translation and language learning more fun and the participants found TransAhead very recommendable and would like to use the system again in future translation tasks Acknowledgement...
  • 4
  • 393
  • 0
Tài liệu A Science Roadmap for Food and Agriculture pdf

Tài liệu A Science Roadmap for Food and Agriculture pdf

Cao đẳng - Đại học

... interfaces between animal agriculture and landscapes (natural, managed, and urban) New initiatives to characterize the genetic architecture and resources of various agriculture animals and aquaculture ... more accurate estimates of climate change impacts, the potential costs and benefits of adaptation, and to validate and calibrate models • Quantify costs and benefits of adaptation at the farm ... collaborations and data exchange systems that establish food security and safety • National policies for systems-based sustainable production of abundant and safe food • Standardized management systems and...
  • 104
  • 415
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "TOWARDS A CORE VOCABULARY FOR SYSTEM A NATURAL LANGUAGE" potx

Báo cáo khoa học

... for an extendcd vocabulary in Ihc lexical database of the IJ:,X project (llamett ct al., 1986) This database also conlains dctailcd syntactic inforuaation, in pa~l.icular on government patterus ... objectives of natural language systems It has been shown that both statistical mclhods and semanlic criteria can, and I think, have to contribute to the establishment of a core vocabulary The work ... vocabulary serving as a base for applying semantic criteria, becat, se the overall core vocabulary was envisaged to have a size of approx 1500 words Inspection shows that many intuitively basic...
  • 3
  • 409
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx

Báo cáo khoa học

... the translations we have allocated to the lexical items in our vocabulary will be generated Tibia is true of all NL s!/stems that translate from a natural language into some formal representation ... system are acceptable as they are proposed, is more flexible than any approach which depends on getting a reaiisable expression of the representation language from the application program and systematically ... approach to generating text from a given logical form is described The algorithm described by Shieber and his colleagues takes a realisable A- calculus expression and uses their syntactic/semantic...
  • 4
  • 501
  • 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Sức khỏe giới tính

... is variability in coverage among states Additionally, there are racial and ethnic disparities in childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children ... John Ward, Dale Hu, Cindy Weinbaum, and David Bell, Centers for Disease Control and Prevention; Chris Taylor and Martha Saly, National Viral Hepatitis Roundtable; Lorren Sandt, Caring Ambassadors ... hepatitis B and hepatitis C and guidance on reducing them Information about health disparities related to hepatitis B and hepatitis C To increase knowledge and awareness about hepatitis B and...
  • 191
  • 457
  • 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Sức khỏe giới tính

... and C http://www.nap.edu/catalog/12793.html Acronyms and Abbreviations AASLD ACIP ACOG AHRQ AIDS ALT anti-HBc anti-HBs anti-HCV API AST AVHPC American Association for the Study of Liver Diseases ... childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children have lower vaccination rates than non-Hispanic white children Regarding vaccination of children and ... state and local governments, professional organizations, health-care organizations, and educational institutions) to develop hepatitis B and hepatitis C educational programs for health-care and...
  • 253
  • 369
  • 0
Hate on the Internet: A Response Guide for Educators and Families pptx

Hate on the Internet: A Response Guide for Educators and Families pptx

Quản trị mạng

... Partners Against Hate Hate on the Internet: A Response Guide for Educators and Families represents a collaborative effort of the Anti-Defamation League (ADL), National Chair, Barbara Balser and ... sites that include hate propaganda from the National Alliance and David Duke “If you are a teacher or student, I hope you will take a stand for right and wrong and use this information to enlighten ... 15 The National Alliance Web site features transcripts from a weekly anti-Semitic radio broadcast, online access to many articles from the group’s National Vanguard magazine, and a catalog of...
  • 63
  • 1,433
  • 0
Báo cáo khoa học: Purine nucleoside phosphorylases from hyperthermophilic Archaea require a CXC motif for stability and folding pot

Báo cáo khoa học: Purine nucleoside phosphorylases from hyperthermophilic Archaea require a CXC motif for stability and folding pot

Báo cáo khoa học

... folding catalysts (reactivation assay) The catalytic activity of (A) SsMTAPII and SsMTAPIIC259S ⁄ C261S and (B) PfPNP and PfPNPC254S ⁄ C256S was then measured under standard assay conditions The activity ... was analyzed by catalytic activity measurements performed under standard conditions Reactivation assay of SsMTAPII, PfPNP and their CXC-lacking mutants The activity of SsCSC and PfCGC as catalysts ... concentration of mm was then added and A2 96, as a result of RNase-catalyzed cCMP hydrolysis, was monitored continuously for 210 at 30 °C The positive control was the reactivation of sRNaseA catalyzed...
  • 7
  • 496
  • 0

Xem thêm