towards a universal platform for scientific and statistical computing

... the CAS file Manual annotations All annotations created manually through a paper viewer and curation interface are first stored in a Postgres database A periodically run application will analyze ... the paper are also available The curator can select arbitrary text spans that can be used to fill a fully-configurable web-based curation form, and make manual annotations with it Once the curation ... relationships All categories and the terms in their respective lexicon are stored in a Postgres database A UIMA annotator analyzes the SofA string of a CAS file and appends all found lexical annotations

Ngày tải lên: 25/11/2020, 15:21

... single-cell analysis, which includes separation of a cell from the bulk as well as delivery of this particular cell to downstream biological analyses Compared with animal and plants cells, capture and ... demonstrated We further showed that the individual cells isolated can be used in high-quality DNA and RNA analyses at both gene-specific and whole-genome levels (i.e real-time quantitative PCR and ... to perform, however, they usually suffer greatly from being imprecise, hard to validate and prone to DNA contamination More automated methods such as optical/magnetic tweezers6 Raman-activated

Ngày tải lên: 24/11/2022, 17:54

... definition of a platform for an integrated and harmonized noise Action Plan and proposals for revision of Italian legislation and END Directive; Proceedings of AIA-DAGA Congress, Merano, Italy, 2013 ... Diego Palazzuoli, and Arnaldo Melloni LIFE+2008 HUSH project results: a new methodology and a new platform for implementing an integrated and harmonized noise Action Plan and proposals for updating ... area in an agglomeration and quiet area in open country Member States have to define Quiet Areas (QAs), may set supplementary noise indicators for QAs and have to show in the Action Plans measures

Ngày tải lên: 04/12/2022, 15:03

... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast ... C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases Parimala R Vajjhala1,2, Chau H Nguyen1,2, ... Francisco, CA, USA) Horseradish peroxidaseconjugated goat anti-(mouse IgG) and gel-filtration standards were from Bio-Rad Laboratories (Hercules, CA, USA) Penta His mAb and Ni-NTA agarose were from Qiagen

Ngày tải lên: 07/03/2014, 05:20

... SLIDE 3 0031003 Acknowledgments This is a presentation of the American Academy of Family Physicians supported by an educational grant from Aventis Pharmaceuticals The AAFP gratefully acknowledges Harold ... volume, and composition, – normal mucociliary flow to prevent mucous stasis and subsequent infection; – and open sinus ostia to allow adequate drainage and aeration. • Senior BA, Kennedy DW. Management ... Differentiate acute from chronic sinusitis • Evaluate patients by history, physical exam, appropriate laboratory and imaging studies, and when indicated screen patients for allergy • Prescribe appropriate

Ngày tải lên: 16/03/2014, 14:20

... Western and Eastern Germany Vienna Institute of Demography Austrian Academy of Sciences Wohllebengasse 12-14 A- 1040 Vienna · Austria E-Mail: vid@oeaw.ac.at Website: www.oeaw.ac.at/vid Abstract We ... Diseases of Elderly Women and Men: A Longitudinal Analysis for Western and Eastern Germany Christian Wegner and Marc Luy Introduction In general, the health status at old age has an important ... classified in detail All analysed health variables were dichotomised into ‘good’ and ‘bad’ in the case of the general health status and into ‘presence’ and ‘absence’ for each specific disease and multimorbidity

Ngày tải lên: 22/03/2014, 13:20

... the RAND Corporation. CHILDREN AND FAMILIES EDUCATION AND THE ARTS ENERGY AND ENVIRONMENT HEALTH AND HEALTH CARE INFRASTRUCTURE AND TRANSPORTATION INTERNATIONAL AFFAIRS LAW AND BUSINESS NATIONAL ... streams and annual appropriations NASA (an IGA) receives annual appropriations In the case of annual appropriations, the Senate and House will be required to authorize and appropriate ... 43 Critical Organizational Attributes 45 Structural and Procedural Features and Analysis of Organizational Models 50 Discriminating Among Organizational Models 62 CHAPTER FIVE Designing a New Management

Ngày tải lên: 23/03/2014, 00:20

... Becker, Carla Dauw and Tania Braems at the Belgian Directorate General for Development Cooperation and Nicole Malpas at the Belgian Technical Cooperation for their enthusiast cooperation and support ... constitutes a real challenge for donors, international humanitarian agencies, national authorities, national and international non-governmental organizations, and community based organizations The ... international expert meeting in Ghent o UNFPA-Jerusalem, the men and women of Juzoor and the women in the Jalazou, Jabalyia and Amari Refugee Camps in the West Bank and the Gaza for their warmhearted

Ngày tải lên: 28/03/2014, 14:20

... CENTRAL ADMINISTRATIVE SUPPORT DEPARTMENTS INFORMAL CONFLICT MANAGEMENT PROCEDURE ADMINISTRATIVE OFFICIAL: DELEGATED AUTHORITY, RESPONSIBILITY, AND AREAS OF POTENTIAL RISK ACADEMIC AND RESEARCH AFFAIRS ... (i.e., monthly) to ensure that charges? ?and? ?credits are  valid  and? ? that  adequate  supporting  documentation  is available.  D A? ?method to determine? ?and? ?document the cause of  significant deviations.  E A? ?method? ?for? ?taking corrective actions that include:  ... DaFIS? ?and? ?PPS are the official financial? ?and? ?payroll systems  of  UC  Davis.    Departments  may  have  a? ? system  of  paper  timesheets  and? ? documents, spreadsheets? ?and? ?databases,  or  combinations  of  paper  and? ?

Ngày tải lên: 29/03/2014, 20:20

... content classification: to develop a generally valid approach to age-rating, which could be used across sectors and provide parents with understandable age categories; (4) Wider availability and ... 1 http://europa.eu/rapid/pressReleasesAction.do?reference=IP/12/445 &format=HTML&aged=0&language=EN&guiLanguage=en 2 http://europa.eu/rapid/pressReleasesAction.do?reference=IP/11/148 5&format=HTML&aged=0&language=EN&guiLanguage=en new findings and analysis to help establish a baseline ... media that disseminate information and material of social and cultural benefit to the child, with particular regard to the... opposed to pure age-based rating, which may be too general and say little

Ngày tải lên: 29/03/2014, 20:20

... repugnant to many people Same-sex lovers planning to adopt face additional potential barriers: • state laws barring adult adoptions—Alabama, Arizona, Hawaii, Michigan, Nebraska and Ohio all... ... Fred was a friend and colleague of Hayden’s,... are many similar experiences in being a lesbian and being a gay man (calling a lesbian a ‘Dyke’ and calling a gay man a ... sodomy law Maryland No sodomy law Massachusetts Heterosexual and homosexual sodomy illegal 20 years Michigan Heterosexual and homosexual sodomy illegal 15 years Minnesota Heterosexual and

Ngày tải lên: 18/04/2014, 14:03

... separability, and identified the more effective channels and frequency bands for control We calculated each Bhattacharyya distance according to (1), where Mi and Σi are the mean vector and covariance ... software system for EEG data acquisition and processing TAK also assisted with data collection, performed the data analysis, and drafted and revised the manuscript OB developed the Matlab-based ... one male, with ages ranging from 24–55 years Subject A was female, age 53 years Subject B was female, age 55 years Subject C was female, age 24 years Subject D was male, age 32 years We also carried

Ngày tải lên: 19/06/2014, 08:20

... RESEARCH Open Access Application of a MANET Testbed for horizontal and vertical scenarios: performance evaluation using delay and jitter metrics Masahiro Hiyama 1* , Elis Kulla 1* , Tetsuya Oda ... function. We can save the data for these parameters in a text file and can Figure 2 Horizontal obstacle topology scenarios. A: HOS, B: HOM. Hiyama et al . Human-centric Computing and Information Sciences ... several fields such as collaborative computing and communications in indoor areas. Mobility and the absence of any fixed infrastructure make MANETs very attractive for mobility and rescue operations

Ngày tải lên: 21/06/2014, 06:20

... estimation A tool, named PECES, was implemented for automatizing the method Additionally, a measuring platform, named AMALGHMA, was constructed for characterizing the platform and for comparing ... The AMALGHMA (Advanced Measurement Algorithms for Hardware Architectures) tool has been implemented for automating the measuring activities AMALGHMA adopts a set of statistical methods, such as ... model a real platform, namely, NXP LPC2106, and a theoretical multiprocessor platform The high level of abstraction of the proposed models allows for fast but accurate estimates Additionally, although

Ngày tải lên: 21/06/2014, 11:20

... SR1D4F TAGAATTCGTGAGCAGATCATGT DNA-shift assay P D4 SR1D4R TAGAATTCCATTGTGAACCATC SD2R1F TAGAATTCATCGCCACGACCATG DNA-shift assay P R1 SD2R1R TAGAATTCCGCGGTTCGGCAGA simX5D3F TAGAATTCTGTACAAGGCCTGGT ... TAAAGCTTCAAAACGGGGTGAAC DNA-shift assay P A7 simA7R ATAAGCTTGTCGATACCGATCTTC PEx2F ACTTCCCAGAAGTA DNA-shift assay P Ex2 PEx2R AGAGGGCAGTAGAC PR3F TTTCTAGATGCACCCGATCCTC DNA-shift assay P SR3 PR3R GAACAGGATTCGCATGAGTACT ... TAGAATTCTGTACAAGGCCTGGT DNA-shift assay P D3 simX5D3R TAGAATTCGCGACAGGAGCCATA simEXX4F TAGAATTCGACGCCTTCCAGTC DNA-shift assay P X4 simEXX4R TAGAATTCTCAGAACATCGTCC SR2ExXF AAATCTAGATCAAGCCAGTGCTG DNA-shift assay P

Ngày tải lên: 21/06/2014, 17:20

... Tag transmits Command errors Collision ACK command is ‘0’ Successful: ACK command is ‘1’ Silent - ID Reader command, ACK command Reader command, ACK command Kill command Destroyed Figure 2: ASAP: ... per- formance deteriorates, although not significantly, as the dif- ference between the optimal and offered frame size increases. [...]... ASAP to variants of ASAP, that is, p-ASAP, m-ASAP, and ASAP ... “identified” state and negatively acknowl- edged tags transition to the “activated” state. Subsequent to the transmission of the “ACK command,” the reader broad- casts a new “reader command” and a new

Ngày tải lên: 22/06/2014, 19:20

... Fanjason Ramahaleomiarantsoa, Eric Jean Roy Sambatra, Nicolas Hộraud and Jean Marie Razafimahenina Chapter Dynamic and Quasi-Static Simulation of a Novel Compliant MEMS Force Amplifier by Matlab/Simulink ... Balogh, Pavel Zỏskalický, S Chountasis, V.N Katsikis, D Pappas, Mohammed Z Al-Faiz, Abbas H Miry, Ramy Saad, Sebastian Hoyos, Samuel Palermo, Momoh-Jimoh E Salami, Ismaila B Tijani, Abdussamad ... Transformer Using Matlab 219 Adel Aktaibi and M Azizur Rahman Chapter 11 PH Control Using MATLAB 243 Mostefa Ghassoul Chapter 12 An Advanced Transmission Line and Cable Model in Matlab for the...

Ngày tải lên: 29/06/2014, 09:20

... Prokop, Walid Hassairi, Moncef Bousselmi, Mohamed Abid, Carlos Valderrama, Moulay Tahar Lamchich, Nora Lachguer, Gaizka Almandoz, Gaizka Ugalde, Javier Poza, Ana Julia Escalada, Oriol Font-Bach, Antonio ... Software for Design and Analysis of Electrical Machines 161 Gaizka Almandoz, Gaizka Ugalde, Javier Poza and Ana Julia Escalada Section Telecommunication-Communication Systems 185 Chapter MATLAB as ... in Matlab: Issues and Impairments 217 Bahman Azarbad and Aduwati Binti Sali Chapter 11 Wireless Channel Model with Markov Chains Using MATLAB 235 Diana Alejandra Sánchez-Salas, José Luis Cuevas-Ruíz...

Ngày tải lên: 29/06/2014, 09:20

... research aims The XGAP data format can be used to represent and exchange all raw, intermediate and result data associated with an investigation, and an XGAP database, for instance, can be used as a platform ... file format to exchange data using this model (XGAP-TAB) and easy-to-customize database software (XGAP-DB) that will help groups to directly use and adapt XGAP as a platform for their particular ... Data, and DataElement For example: a single-channel microarray reports raw gene expression Data for each microarray probe Trait and each individual Subject Add information on data provenance by...

Ngày tải lên: 09/08/2014, 20:21