... Publisher. All rights reserved Research Paper Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-Up ... facet joint nerve blocks with or without steroids in managing chronic low back pain of facet joint origin. Summary of Back...
Ngày tải lên: 26/10/2012, 09:07
... Chiến lược Marketing 6 1.1.3.3 Chiến Lược Marketing du lịch .7 1 1 . . 2 2 Vai trò c a chiến lược Marketing du lịch đ a phương 7 1.2.1 V V a a i i t t r r ò ò c c ủ ủ a a c c h h i i ế ế n n ... hiện nay đang phát triển theo ba xu hướng chính: Xu hướng Mỹ: Chú trọng phát triển Marketing theo hướng nghiên cứu quan hệ gi a định hướng thị trường và các h...
Ngày tải lên: 08/04/2013, 17:02
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
... cleaning of all dairy apparatus that in any way comes in contact with the milk is one of the most fundamental and important problems in dairying. All such apparatus should be so constructed as ... possess the faculty of growing either as parasites or saprophytes, in which case they are known as facultative parasites or saprophytes. The great majority of bacteria...
Ngày tải lên: 16/02/2014, 22:20
Tài liệu STRENGTHEN CONFIDENCE AND WORK TOGETHER FOR A NEW ROUND OF WORLD ECONOMIC GROWTH doc
...
Ngày tải lên: 21/02/2014, 01:20
Tài liệu Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilian pulp and paper industry potx
... Ripasa and International paper are integrated producers of the writing and printing paper. By calculating the average of the three Brazilian companies and comparing with the international Paper ... in the Americas Discussion Paper Number 8 Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilia...
Ngày tải lên: 22/02/2014, 09:20
Towards a safer use of the Internet for children in the EU – a parents’ perspective ppt
... was the third most popular source for information about safe Internet use in a majority of the countries, in half of the countries less than one-third of the parents used it as a source of information: ... Flash EB N o 248 – Safe Internet for children Analytical report page 50 Using filtering and monitoring software and parents’ Internet u...
Ngày tải lên: 29/03/2014, 19:20
Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx
... S. litura and Amsacta albistriga polyhedrin genes (Acc# X94437 and AF118850 , respectively) and 85% with S. exigua and Malacosoma neustria polyhedrin gene (Acc# AF169823 ; AY127899 and AJ277555, ... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT 63 |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AcMNPV 1484 AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGG...
Ngày tải lên: 20/06/2014, 01:20
EFT for Back Pain: A Specialized Use of Emotional Freedom Techniques doc
... immediately and offer suggestions as EFT for Back Pain: A Specialized Use of Emotional Freedom Techniques 16 Chapter Two: EFT for Back Pain Your back hurts, and you’re not alone. At least ... understand its basic formula but aren’t sure what to do with it. They may have a hunch that their back pain – or the back pain of someone they are try...
Ngày tải lên: 29/06/2014, 09:20
báo cáo khoa học: " The use of telehealth for diabetes management: a qualitative study of telehealth provider perceptions" pot
... because of informa- tion already available about a patient. In other cases, telehealth providers called patients for more information. When patients are contacted, the reason for the alert is sometimes ... to the telehealth provider& apos;s workload A major theme to emerge concerning the use of MMDs was the time required for the use of the MMD system an...
Ngày tải lên: 11/08/2014, 05:22
Báo cáo y học: "The Nordic maintenance care program – case management of chiropractic patients with low back pain: A survey of Swedish chiropractors" doc
... for citation purposes) Chiropractic & Osteopathy Open Access Research The Nordic maintenance care program – case management of chiropractic patients with low back pain: A survey of Swedish ... that each strategy was selected for each scenario was calculated. Finally, the proportion of so-called " ;maintenance care& quot; patients on the da...
Ngày tải lên: 13/08/2014, 14:20
Báo cáo y học: "A diagnosis-based clinical decision rule for spinal pain part 2: review of the literature" pps
... signs. Validity As with the cervical spine, the validity of myofascial signs in the lumbar spine is unknown due to the absence of a Gold Standard for the identification of myofascial pain. 3. What ... purposes) Chiropractic & Osteopathy Open Access Review A diagnosis-based clinical decision rule for spinal pain part 2: review of the literature...
Ngày tải lên: 13/08/2014, 14:20
Báo cáo y học: "The Nordic back pain subpopulation program - individual patterns of low back pain established by means of text messaging: a longitudinal pilot study" pdf
... individual patterns of low back pain established by means of text messaging: a longitudinal pilot study Alice Kongsted* 1 and Charlotte Leboeuf-Yde 2,3 Address: 1 Nordic Institute of Chiropractic ... deals only with the number of days that subjects were bothered by their lower back, as reported on a weekly basis. Data analysis Data were transmitted f...
Ngày tải lên: 13/08/2014, 14:20
Báo cáo y học: "Routine versus needs-based MRI in patients with prolonged low back pain: a comparison of duration of treatment, number of clinical contacts and referrals to surgery" pdf
... article as: Jensen et al.: Routine versus needs-based MRI in patients with prolonged low back pain: a comparison of duration of treatment, number of clinical contacts and referrals to surgery. Chiropractic ... Access Routine versus needs-based MRI in patients with prolonged low back pain: a comparison of duration of...
Ngày tải lên: 13/08/2014, 14:20
Báo cáo y học: "SPECT/CT imaging of the lumbar spine in chronic low back pain: a case report" docx
... pool imaging followed by a delayed whole-body scan. SPECT/CT imaging centered over the lumbar spine was subsequently performed on a Symbia T6 (Siemens), a dual-head gamma-camera incor- porating a ... reported that no spinal imaging had been performed in investigation of these complaints. This was confirmed by a review of the patient’s records. Physical Examinatio...
Ngày tải lên: 13/08/2014, 15:21
Báo cáo y học: " Delineating inflammatory and mechanical subtypes of low back pain: a pilot survey of fifty low back pain patients in a chiropractic setting" doc
... Riksman et al.: Delineating inflammatory and mechanical sub-types of low back pain: a pilot survey of fifty low back pain patients in a chiropractic setting. Chiropractic & Manual Therapies 2011 ... (no pain) to 10 (worst pain ima- ginable) [14,15] and LBP-related disability was measured using an Oswestry Disability Questionnaire (ODQ) [16]....
Ngày tải lên: 13/08/2014, 15:21