ATOMIC FORCE MICROSCOPY – IMAGING, MEASURING AND MANIPULATING SURFACES AT THE ATOMIC SCALE doc

... beam). With the experimental 25 Atomic Force Microscopy in Optical Imaging and Characterization Atomic Force Microscopy – Imaging, Measuring and Manipulating Surfaces at the Atomic Scale 6 ... period-to-linewidth 33 Atomic Force Microscopy in Optical Imaging and Characterization Atomic Force Microscopy – Imaging, Measuring and...

Ngày tải lên: 28/06/2014, 14:20

... “Start” to measure the Q-curve and the phase curve. Computer calcu- lates the optimal value for the vibration frequency (operation point) immedi- ately and displays the values with the Q-curve. An ... to the sample, during this portion of the curve the tip can indent the surface. The tip is then withdra wn towards positions C and D. At position D, under applicati...

Ngày tải lên: 11/04/2014, 02:07

... as a hole, the lateral size and depth can appear too small and the tip may not reach the bottom. The geometry of the probe will dominate the geometry of the sample as is apparent from the line ... difference between the trace and retrace plots. • Change the scan size and take an image to ensure that the features scale properly. • Rotate the sample and take...

Ngày tải lên: 27/06/2014, 08:20

... distribution with the height 1. 8–2 .6 nm reached (51 ± 8)%. Appearance of the positive wing allows us to conclude that the increase in the number of objects with the height 1. 8–2 .6 nm and the hmax at 2.3 ... of isolated Ad and CYP11A1 mon upon their complex formation. At the same time, we have made an attempt to reveal the Ad/CYP11A1 mon complex formation by th...

Ngày tải lên: 21/06/2014, 11:20

... two synthesized oligonucleotides P his (5¢-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3¢) and P MluI (5¢-GTACACGCG TCTGATCAG-3¢) were inserted into the 3¢-end of the pYES2–VPP plasmid ... membranes with atomic force microscopy. FEBS Lett 504, 19 4–1 99. 17 Yuan C & Johnston LJ (2001) Atomic force microscopy studies of ganglioside GM1 domains in phosphatidy...

Ngày tải lên: 16/03/2014, 02:20

... quantitative analysis further showed that the surface roughness of the mature BMDCs greatly increased and that the adhesion force of them was fourfold more than that of the immature BMDCs. The nano-features ... pathways are implicated in the events of D Cs maturation [27]. The differentiation and maturation of DCs require more synthetic materials and energy production, w...

Ngày tải lên: 21/06/2014, 02:20

... intermediate density of the dimer lattice, on the other hand, indicates that the dimer organization might be a transient configura- tion between 90° square lattice and others. Tilting of LH2 Our ... in the formation of functional photosynthetic domains and membrane curvature. To further investigate in detail the packing effects of like-protein photosyn- thetic complexes, we repor...

Ngày tải lên: 18/02/2014, 18:20

... Pyr/Pur sequence isolated from the rat genome. The studies revealed the formation of alternative local DNA structures of different shapes. MATERIALS AND METHODS DNA A pUC19 derivative, pTIR10, containing ... (GAA/TTC) n triplet repeat in the first intron of the human frataxin gene (sticky DNA) [20], and formation of the sticky DNA directly correlates to the inhibitory effect...

Ngày tải lên: 31/03/2014, 23:20

... scratched grooves at different scratch speeds. (a) The AFM images of the scratches at 10 μN of applied force in the forward scratch. (b) Correlation of the size of the scratched grooves with the ... nm, respectively. The associated coefficient of determination (R 2 )is0.99ford and 0.88 for W f , which indicate that the power-law correlation fitting the depth data per...

Ngày tải lên: 21/06/2014, 00:20

... lly, the contiguous ques tion of local modificatio n of the CNT and substrate surface is raised after operating at various bias voltages with diamond tips. Methods and materials Elaboration and ... refer ence material surface to investigate the electrical transport properties of the MWCNTs. The dispersion solution containing CNTs was then deposited onto these substrates. At...

Ngày tải lên: 21/06/2014, 04:20