Báo cáo nghiên cứu khoa học " GENOTYPING OF COMMON CARP STRAINS " pot
Báo cáo nghiên cứu khoa học " GENOTYPING OF COMMON CARP STRAINS " pot
... GTTTATCTGAACCTGCAGCTCCTC
Table 5.5. Characteristics of Cyprinus carpio microsatellite loci tested
1
GENOTYPING OF COMMON CARP STRAINS
BINH, T.T., TAN, N.T., HUNG, L.Q., ... yellow (haplotypes B
& D) carp strains from RIA 1. In addition, common carp samples from China
(haplotypes I & R) and Indonesian (haplotypes B, D &J) and...
Báo cáo nghiên cứu khoa học " Status of common carp in Vietnam " pptx
... Common carp breeds cultured
15.09
21.70
57.55
5.66
0
20
40
60
80
Local Selective Hybrid Others
Source of carp brood change
Brood common carp
addition or change from ... technique for common carp at both state
and private hatcheries, re-production 1-3 per year.
Common carp production
Breeding methods:
A artificial technique applies for common
carp in both ... H...
Báo cáo nghiên cứu khoa học " Characterization of vaccine candidate strains for E. coli vaccine " ppt
...
Table 4:
Duration of diarrhoea and excretion of challenge strains in piglets born from vaccinated
ilts and unvaccinated controls
Diarrhoea
(average days)
Excretion of
challenge strain ...
Table 3:
Frequency of diarrhoea and excretion of challenge strain in piglets born from vaccinated
gilts and unvaccinated controls
No. of piglets with
diarrhoea (%)
No. of piglet...
Báo cáo nghiên cứu khoa học " Evolution of Evolution of IPM " pptx
... communities
Religious
groups
Impact of insecticides on
Impact of insecticides on
predators
predators
The insecticide sprays
The insecticide sprays
in citrus orchards
in citrus orchards
cause of red
cause of red
-
-
mite ... keeping for natural enemies
Weed keeping for natural enemies
habitat
habitat
Báo cáo nghiên cứu khoa học " Management of Phytophthora diseases in Vietnamese horticulture - MS2 " potx
...
Contact Officer(s)
In Australia: Team Leader
Name:
Professor David Guest
Telephone:
(02) 9352.3946
Position:
Professor of Horticulture
Fax:
(02) 9351.4172
Organisation
The University of ... copy (CD). The manual included
copies of all presentations, some of which were translated into Vietnamese and
translations of selected relevant chapters of ACIAR Monograph No 14 (...
Báo cáo nghiên cứu khoa học " Improvement of export and domestic markets for Vietnamese fruit through improved post-harvest and supply chain management - MS2 " docx
... management of Supply/Value Chains
In any society the availability and costs of food are closely linked with many of areas
of the countries society. La Gra (1990) states that decisions, of what ... one (2005) total
payment of $139,403 was budgeted for.
As per the Table of Milestone schedule (Annex 1 of Schedule 2) in the contract for
the first year payment of $162,135...
Báo cáo nghiên cứu khoa học " Improvement of export and domestic markets for Vietnamese fruit through improved post-harvest and supply chain management - MS3 " ppt
... analysis of existing supply chains with future collaboration encouraged.
The Vietnamese project team is also well represented with women making up the
majority of team members from SOFRI (3 of ... project implementation. The SOFRI team is lead by
experienced scientist and extensionist Dr Hong who is committed to the professional
development of female staff. A number of young f...
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs " pptx
...
testing of sera in each laboratory was discussed. Training of staf at RAHC-
HCMC in the use of molecular techniques for the detection of FMD and the
sequencing of FMD isolates. Training of RAHC-HCMC ...
Education of farmers
to allow better
understanding of the
benefits of diagnostic
technologies.
Pilot zones
Establishment of an effective laboratory
network fo...
Báo cáo nghiên cứu khoa học " Management of Phytophthora diseases in Vietnamese Horticulture - MS3 " pot
... second milestone of CARD project number
052/04/VIE.
4. Introduction & Background
The diverse geographic and climatic regions of Vietnam enable the cultivation of a broad
range of plants. Tropical ... FTRDC-Hue and SOFRI-My Tho. A total of 80 extension personnel
participated in the workshops. The actual target 75 participants.
3. Distribution of training manuals to partic...
Báo cáo nghiên cứu khoa học " Management of Phytophthora Diseases in Vietnamese Horticulture - MS5 " pptx
... Protection in Brisbane and Prof Guest and Dr Rosalie Daniel at
The University of Sydney.
10
more accepting of this form of application when they see the results of phosphonate as a
method ... disease
9
Inclusion of on-farm trials and the expansion of extension activities will enable
dissemination of knowledge acquired during the workshops to promote awareness of the...
Từ khóa:
- báo cáo nghiên cứu khoa học quả quất
- cách trình bày báo cáo nghiên cứu khoa học
- báo cáo nghiên cứu khoa học về kinh tế
- báo cáo nghiên cứu khoa học môi trường
- báo cáo nghiên cứu khoa học giáo dục
- báo cáo nghiên cứu khoa học powerpoint
- báo cáo nghiên cứu khoa học mẫu
- báo cáo nghiên cứu khoa học của sinh viên
- báo cáo nghiên cứu khoa học sinh viên