Báo cáo nghiên cứu khoa học " GENOTYPING OF COMMON CARP STRAINS " pot

Báo cáo nghiên cứu khoa học " GENOTYPING OF COMMON CARP STRAINS " pot

Báo cáo nghiên cứu khoa học " GENOTYPING OF COMMON CARP STRAINS " pot

... GTTTATCTGAACCTGCAGCTCCTC Table 5.5. Characteristics of Cyprinus carpio microsatellite loci tested 1 GENOTYPING OF COMMON CARP STRAINS BINH, T.T., TAN, N.T., HUNG, L.Q., ... yellow (haplotypes B & D) carp strains from RIA 1. In addition, common carp samples from China (haplotypes I & R) and Indonesian (haplotypes B, D &J) and...

Ngày tải lên: 22/06/2014, 12:20

23 263 0
Báo cáo nghiên cứu khoa học " Status of common carp in Vietnam " pptx

Báo cáo nghiên cứu khoa học " Status of common carp in Vietnam " pptx

... Common carp breeds cultured 15.09 21.70 57.55 5.66 0 20 40 60 80 Local Selective Hybrid Others Source of carp brood change  Brood common carp addition or change from ... technique for common carp at both state and private hatcheries, re-production 1-3 per year. Common carp production  Breeding methods:  A artificial technique applies for common carp in both ... H...

Ngày tải lên: 22/06/2014, 12:20

19 453 0
Báo cáo nghiên cứu khoa học " Characterization of vaccine candidate strains for E. coli vaccine " ppt

Báo cáo nghiên cứu khoa học " Characterization of vaccine candidate strains for E. coli vaccine " ppt

... Table 4: Duration of diarrhoea and excretion of challenge strains in piglets born from vaccinated ilts and unvaccinated controls Diarrhoea (average days) Excretion of challenge strain ... Table 3: Frequency of diarrhoea and excretion of challenge strain in piglets born from vaccinated gilts and unvaccinated controls No. of piglets with diarrhoea (%) No. of piglet...

Ngày tải lên: 22/06/2014, 12:20

16 378 0
Báo cáo nghiên cứu khoa học " Evolution of Evolution of IPM " pptx

Báo cáo nghiên cứu khoa học " Evolution of Evolution of IPM " pptx

... communities Religious groups Impact of insecticides on Impact of insecticides on predators predators   The insecticide sprays The insecticide sprays in citrus orchards in citrus orchards cause of red cause of red - - mite ... keeping for natural enemies Weed keeping for natural enemies habitat habitat

Ngày tải lên: 22/06/2014, 12:20

54 298 0
Báo cáo nghiên cứu khoa học " Management of Phytophthora diseases in Vietnamese horticulture - MS2 " potx

Báo cáo nghiên cứu khoa học " Management of Phytophthora diseases in Vietnamese horticulture - MS2 " potx

... Contact Officer(s) In Australia: Team Leader Name: Professor David Guest Telephone: (02) 9352.3946 Position: Professor of Horticulture Fax: (02) 9351.4172 Organisation The University of ... copy (CD). The manual included copies of all presentations, some of which were translated into Vietnamese and translations of selected relevant chapters of ACIAR Monograph No 14 (...

Ngày tải lên: 22/06/2014, 12:20

8 417 1
Báo cáo nghiên cứu khoa học " Improvement of export and domestic markets for Vietnamese fruit through improved post-harvest and supply chain management - MS2 " docx

Báo cáo nghiên cứu khoa học " Improvement of export and domestic markets for Vietnamese fruit through improved post-harvest and supply chain management - MS2 " docx

... management of Supply/Value Chains In any society the availability and costs of food are closely linked with many of areas of the countries society. La Gra (1990) states that decisions, of what ... one (2005) total payment of $139,403 was budgeted for. As per the Table of Milestone schedule (Annex 1 of Schedule 2) in the contract for the first year payment of $162,135...

Ngày tải lên: 22/06/2014, 12:20

28 568 0
Báo cáo nghiên cứu khoa học " Improvement of export and domestic markets for Vietnamese fruit through improved post-harvest and supply chain management - MS3 " ppt

Báo cáo nghiên cứu khoa học " Improvement of export and domestic markets for Vietnamese fruit through improved post-harvest and supply chain management - MS3 " ppt

... analysis of existing supply chains with future collaboration encouraged. The Vietnamese project team is also well represented with women making up the majority of team members from SOFRI (3 of ... project implementation. The SOFRI team is lead by experienced scientist and extensionist Dr Hong who is committed to the professional development of female staff. A number of young f...

Ngày tải lên: 22/06/2014, 12:20

21 449 0
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs " pptx

Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs " pptx

... testing of sera in each laboratory was discussed. Training of staf at RAHC- HCMC in the use of molecular techniques for the detection of FMD and the sequencing of FMD isolates. Training of RAHC-HCMC ... Education of farmers to allow better understanding of the benefits of diagnostic technologies. Pilot zones Establishment of an effective laboratory network fo...

Ngày tải lên: 22/06/2014, 12:20

28 446 0
Báo cáo nghiên cứu khoa học " Management of Phytophthora diseases in Vietnamese Horticulture - MS3 " pot

Báo cáo nghiên cứu khoa học " Management of Phytophthora diseases in Vietnamese Horticulture - MS3 " pot

... second milestone of CARD project number 052/04/VIE. 4. Introduction & Background The diverse geographic and climatic regions of Vietnam enable the cultivation of a broad range of plants. Tropical ... FTRDC-Hue and SOFRI-My Tho. A total of 80 extension personnel participated in the workshops. The actual target 75 participants. 3. Distribution of training manuals to partic...

Ngày tải lên: 22/06/2014, 12:20

8 346 0
Báo cáo nghiên cứu khoa học " Management of Phytophthora Diseases in Vietnamese Horticulture - MS5 " pptx

Báo cáo nghiên cứu khoa học " Management of Phytophthora Diseases in Vietnamese Horticulture - MS5 " pptx

... Protection in Brisbane and Prof Guest and Dr Rosalie Daniel at The University of Sydney. 10 more accepting of this form of application when they see the results of phosphonate as a method ... disease 9 Inclusion of on-farm trials and the expansion of extension activities will enable dissemination of knowledge acquired during the workshops to promote awareness of the...

Ngày tải lên: 22/06/2014, 12:20

10 404 0
w