Báo cáo hóa học: " A comparative study of non-covalent encapsulation methods for organic dyes into silica nanoparticles" pptx

... this article as: Auger et al.: A comparative study of non-covalent encapsulation methods for organic dyes into silica nanoparticles.Nanoscale Research Letters 2011 6:328.Submit your manuscript ... NANO EXPRESS Open Access A comparative study of non-covalent encapsulation methods for organic dyes into silica nanoparticlesAurélien Auger*, Jorice Samuel, Olivier Poncelet and Olivier RaccurtAbstractNumerous ... of biological assays and have reached great expectations[10,11]. The wide range and variety of fluorophoresavailable nowadays facilitate the targeting of suitableapplications for the newly prepared...

Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

... Linguistics A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing Jianfeng Gao*, Galen Andrew*, Mark Johnson*&, Kristina Toutanova* *Microsoft ... Introduction Parameter estimation is fundamental to many sta-tistical approaches to NLP. Because of the high-dimensional nature of natural language, it is often easy to generate an extremely large ... Lasso (L1) regularization. We first investigate all of our estimators on two re-ranking tasks: a parse selection task and a language model (LM) adaptation task. Then we apply the best of...

báo cáo hóa học:" A comparative study of some methods for color medical images segmentation" doc

... abouttypical shape and image data characteristics. But, manual segmentation is a very time-consuming process for the already increasing amount of medicalimages. As a result, reliable automatic methods ... applications: the quantiﬁcation of tissue volumes, diagnosis, localization of pathology, study of anatomical struc-ture, treatment planning, partial volume correction of functional imaging data,and ... the article as it appeared upon acceptance. Fully formattedPDF and full text (HTML) versions will be made available soon. A comparative study of some methods for color medical images segmentationEURASIP...

báo cáo hóa học:" A Comparative Study of HIV/AIDS: The Knowledge, Attitudes, and Risk Behaviors of Schizophrenic and Diabetic Patients in Regard to HIV/AIDS in Nigeria" doc

... characteristics, sexual behaviors,and condom use.Data AnalysesThe data were analyzed using the Statistical Package for Social Sciences (SPSS), version 10.[15] All statistical testswere at 5% probability ... .05).ResultsSociodemographic Characteristics of SubjectsThe age range for both groups of patients was 1950 years(Table 1 ). The mean age of the schizophrenic patients was34.46 ± 7.70 years, while the mean age of ... were aware of the existence of HIV/AIDS. Their main source of information was elec-tronic media (radio and television). The proportion of healthcare providers/institutions as a source of informa-tion...

Báo cáo khoa học: "A Comparative Study of Target Dependency Structures for Statistical Machine Translation" ppt

... Comparative Study of Target Dependency Structures for Statistical Machine TranslationXianchao Wu∗, Katsuhito Sudoh, Kevin Duh†, Hajime Tsukada, Masaaki NagataNTT Communication Science Laboratories, ... Corporation2-4 Hikaridai Seika-cho, Soraku-gun Kyoto 619-0237 Japanwuxianchao@gmail.com,sudoh.katsuhito@lab.ntt.co.jp,kevinduh@is.naist.jp,{tsukada.hajime,nagata.masaaki}@lab.ntt.co.jpAbstractThis ... grammar (HPSG) (Pol-lard and Sag, 1994; Sag et al., 2003) parser, Enju1(Miyao and Tsujii, 2008) and (2) a state -of- the-artCCG parser2(Clark and Curran, 2007). The moti-vation of this paper...

báo cáo hóa học: " A comparative study on approximate entropy measure and poincaré plot indexes of minimum foot clearance variability in the elderly during walking" pptx

... threshold for all features were also calculatedwith ROC areas. All data analyses were performed off-line,using custom software programs written for MATLAB (TheMathworks, Natick, MA).Surrogate data ... subjects, managed data acquisition and par-ticipated to drafting of the manuscript. AHK and MP con-ceived the study, evaluated the data, performed dataanalyses and wrote the manuscript. All authors ... in the application of ApEn to biological signals is thatApEn statistics may be calculated for relatively short series of data which makes it a desirable application for routinediagnosis of possible...

Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

... Micciulla, and J. Makhoul. 2006. A study of translation edit rate with targeted human annotation. In Proceeding of AMTA. T. Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. ... Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the real world. In Proceeding of LREC-2002, Las Palmas de Gran Canaria, Spain. D. Xiong, Q. Liu and ... Ward, and W J. Zhu. 2002. BLEU: a method for automatic evaluation of machine translation. In Proceeding of ACL-2002, pp. 311-318. A. I. Rosti, N. F. Ayan, B. Xiang, S. Matsoukas, R. Schwartz...

Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf

... years ADShave seen a lot of progress and have attracted theresearch community’s and industry’s interest.There is a number of available ADS, apply-ing state of the art techniques for adaptation ... i.e. a disconnected MDP. This can beavoided by making sure that each action is avail-able at some state and that each state has at leastone available action. We should now deﬁne thenecessary ... is a variation of SARSA(λ) that usesthe least squares method to ﬁnd the optimal pol-icy. Incremental Actor Critic (IAC) (Bhatnagaret al., 2007) and Natural Actor Critic (NAC) (Pe-ters et al.,...

Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

... & Fairlamb AH (1999) The biochemicalbasis of arsenical–diamidine cross-resistance in Africantrypanosomes. Parasitol Today 15 , 136–140.6 Frearson JA, Wyatt PA, Gilbert IH & Fairlamb ... andbloodstream parasites results in a complete glyoxalasesystem.Implications for parasite chemotherapyMammalian cells maintain a repertoire of four path-ways for metabolism of methylglyoxal [33], ... Trypanosomacruzi. Biochem J 400, 217–223.16 Padmanabhan PK, Mukherjee A & Madhubala R(2006) Characterization of the gene encoding glyoxa-lase II from Leishmania donovani: a potential target for anti-parasite...

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

... ATATATCATATGTCCGGTGTCGCAAAGR-TryX ATATAGGATCCTTACTCGTCTCTCCACGGF-TryP1 ATATATCATATGTCCTGCGGTAACGCCR-TryP1 ATATAGGATCCTTACTGCTTGCTGAAGTATCF-TDPX1 Cys35Ala CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCGR-TDPX1 Cys35Ala ... CGCCCTTGGTGAAGCCGGCCTTGCTGGCTACGTTGF-TDPX1 Cys64Ala GGTACTGGCGTTCCCGGCCAACCAGTTCGCCGGTCR-TDPX1 Cys64Ala GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACCF-TDPX1 Cys83Ala AGGTGAAAAGTTTCGCCGCCACGCGTTTCAAGGCTGAGR-TDPX1 ... codons of the mutated amino acids are in bold.Cloned protein or mutation primer (5’- to 3’)F-TDPX1 TATATCATATGTCTATCTACGACTTCAAGGTCR-TDPX1 ATATAGGATCCTCACGATTGAGTGCTTGGF-TryX ATATATCATATGTCCGGTGTCGCAAAGR-TryX...

Xem thêm