Báo cáo sinh học: " Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" potx
Báo cáo sinh học: " Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" potx
... [HSV-M13forward 5'-TGTAAAACGACGGCCAGTAGCCTGTAC-CCCAGCAT-3'; HSV-M13 reverse 5'-CAG-GAAACAGCTATGACCTGGGCCTTCACGAAGA-3'].Cycling temperatures were the same as for the HSV real-time ... Virus in cervicovaginal secretions by real-time PCR: a cross sectional surveyEsther AN Aryee1, Robin L Bailey1,2, Angels Natividad-Sancho2, Steve Kaye1 and Martin J Holland*1,2Address: ... African-Americans [6] and in African populations in Uganda, Zimbabwe, Tanzania,Central African Republic, South Africa and The Gambia[7-12]. In The Gambia, HSV-2 seropositivity amongyoung adults...
- 10
- 458
- 0
báo cáo hóa học:" Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" pdf
... done by EANA, MJH and AN; interpretation and laboratory work was conducted by MJH, EANA, AN, SK and RB; EANA, RLB, SK and MJH were responsible foranalysis of results and preparation of the manuscript.AcknowledgementsThe ... Virus in cervicovaginal secretions by real-time PCR: a cross sectional surveyEsther AN Aryee1, Robin L Bailey1,2, Angels Natividad-Sancho2, Steve Kaye1 and Martin J Holland*1,2Address: ... slow and insensitive. We designed a rapid PCR-based assayto quantify and type HSV in cervicovaginal lavage (CVL) fluid of subjects attending a Genito-UrinaryMedicine (GUM) clinic. Vaginal swabs,...
- 10
- 440
- 0
báo cáo sinh học:" The training and expectations of medical students in Mozambique" doc
... nothave any opinion.Regarding the quality of the training received, 52% felt itwas adequate or very adequate, 20% that it was inade-quate or very inadequate and the remainder did not haveany opinion.Expectations ... th year of medicaleducation) on a specified day, during agreed lecture peri-ods, in April and May of 1999 (see Figure 2).All data were entered into an Access database and ana-lysed using SPSS. ... 1998/99 academic year at the Universi-dade Eduardo Mondlane (UEM) Medical Faculty in Maputo, with the aim of identifying their social and geo-graphical origins and their expectations and difficultiesregarding...
- 7
- 493
- 0
báo cáo sinh học:" Appropriate training and retention of community doctors in rural areas: a case study from Mali" pdf
... thetraining and its relevance to practice. This was comple-mented by participant observation and recording of com-ments during the training sessions, aiming at validating and refining the initial ... meant also to address continuity of care and patient-centeredness as characteristics of first line care.Practice management: the module aimed at making participants acquainted with Malian laws and ... of doctors into rural first line practice –unusual in Sub Saharan Africa – lie in Mali's health sectorreform and health labour market evolution, as well as in an incentive package easing...
- 8
- 714
- 0
báo cáo sinh học:" The distribution and transitions of physicians in Japan: a 1974–2004 retrospective cohort study" pot
... physicians, the percentages of physicians working in rural areas and the average ages of physicians. The national population in these years wasobtained by referring to the Japan Population Census and the ... cardiovascular surgery.Possible impact of changes in initial clinical training systemJapan introduced a new clinical training system in 2004, and this will probably affect physicians' career ... Short-age of pediatricians in Japan: a longitudinal analysis usingPhysicians' Survey Data. Pediatr Int 2009 in press.8. Shimada N, Kondo T: Estimation of actual report rates usingdata from...
- 10
- 588
- 0
báo cáo sinh học:" Job satisfaction and motivation of health workers in public and private sectors: cross-sectional analysis from two Indian states" ppt
... satisfaction and motivation of health workers in public and private sectors: cross- sectional analysis from two Indian statesDavid H Peters1*, Subrata Chakraborty2, Prasanta Mahapatra3, Laura Steinhardt1AbstractBackground: ... which was conducted by a separate organiza-tion. To obtain a list of private providers, the startingpoint was a database of facilities maintained by the UPNursing Home Association, which was supplemented ... a ratio-nale for informal payme nts and absentee ism as a means of securing a higher income. Regulation of the privatesector is weak throughout India [34], and many privateorganizations have...
- 11
- 632
- 2
Báo cáo sinh học: " Tumor escape and progression of HER-2/neu negative breast cancer under immune pressure" potx
... primers.ECD-forward: 5’ AAA CTC GAG ATG GAG CTGGCG GCC TTG T 3’ and reverse: 5’ CTT AAG CTTCGT CAG AGG GCT GGC TCT CT 3’ ;ICD-forward:5’ AAACTCGAGAAGCGACGGCAGCAGAAGAT 3’ and reverse: 5’ CTT AAG CTT TCA ... Michael O Idowu2, Margaret M Grimes2, Laura Graham3, Maria-Libera Ascierto4,Ena Wang4, Xiang-Yang Wang5, Harry D Bear3 and Masoud H Manjili1*AbstractBackground: Emerging data from ... dataanalysis, MOI and MMG performed IHC analysis, LG prepared blood samples,M-LA, EW and X-YW participated in drafting the manuscript and dataTable 1 Patients’ characteristicsPatients Stage of tumor...
- 5
- 374
- 0
Báo cáo sinh học: " Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" doc
... relatingto low potency and cost. Peptide-based drug candidatesare limited by insufficient efficacy and unfavorable phar-macokinetics. MAbs have increasingly gained favor in large part because ... OraSure Technologies, Inc. HIV/AIDS MarketCytolin CytoDyn Amerimmune Pharmaceuticals, Inc. HIV/AIDS I/IITipranavir TIPRANAVIR HIV/AIDS IIIHXB AAI International, AnaaiPharma Company Herpes Simplex ... infections, and also carry certain risk for a small, yet significantportion of the population. In the recent years, FDA's approval and subsequent market acceptance of Synagis, a monoclonal antibody...
- 6
- 568
- 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... A. Martin (Institut Pasteur, Paris,France). The primers used were VB1: 5¢-AAACATATGAGCATGAGCTACCACCTGGACC-3¢ and VB3: 5¢-CTCGAGCTTCACAAGAAACTTCTGC-3¢. The PCR fragmentwas cleaved by the restriction ... fragment contains two domains: domainsI and II. Structures of both domain I (A) , as deter-mined by Schuster et al. [13] and by Smith et al. [14], and domain II, as determined, respectively, by ... further incubated at 25 °C for 2 h. Theamount of radioactivity incorporated into the nucleic acids wasmeasured after TCA precipitation and plotted against heparin con-centration. (B) An RdRp assay...
- 15
- 597
- 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt
... later, hemolymph was collected, and fat body RNA samples were prepared from each insect. (A) Antimicrobial activity of plasma assayed against E. coli, and identification of antimicrobial plasma ... protein-2 (betaGRP-2)fromManduca sexta; an acute-phase protein that bindsbeta-1,3-glucan and lipoteichoic acid to aggregate fungi and bacteria and stimulate prophenoloxidase activa-tion. Insect Biochem ... Gel affinity (to remove contaminating fetalbovine serum albumin), concanavalin A affinity,Q-Sepharose anion exchange, and Sephacryl S-300 HRgel permeation. SDS ⁄ PAGE analysis indicated thatproHP8Xawas...
- 15
- 540
- 0
Từ khóa: báo cáo sinh học haybáo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtguidelines for the use of molecular tests for the detection and genotyping of human papilloma virus from clinical specimensdetection quantification and purification of halocins peptide antibiotics from haloarchaeal extremophilesthe economics law and policy of invasive species management in the united states responding to a growing crisiscomplications accompanying signs recurrences and long term sequelae of herpes simplex virus epithelial keratitisbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Chuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ