Báo cáo sinh học: " Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" potx

... [HSV-M13 forward 5'-TGTAAAACGACGGCCAGTAGCCTGTAC- CCCAGCAT-3'; HSV-M13 reverse 5'-CAG- GAAACAGCTATGACCTGGGCCTTCACGAAGA-3']. Cycling temperatures were the same as for the HSV real- time ... Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey Esther AN Aryee 1 , Robin L Bailey 1,2 , Angels Natividad-Sancho 2 , Steve Kaye 1 and...

Ngày tải lên: 19/06/2014, 08:20

... done by EANA, MJH and AN; interpretation and laboratory work was conducted by MJH, EANA, AN, SK and RB; EANA, RLB, SK and MJH were responsible for analysis of results and preparation of the manuscript. Acknowledgements The ... Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey Esther AN Aryee 1 , Robin L Bailey 1,2 , Angels Nat...

Ngày tải lên: 20/06/2014, 04:20

... not have any opinion. Regarding the quality of the training received, 52% felt it was adequate or very adequate, 20% that it was inade- quate or very inadequate and the remainder did not have any opinion. Expectations ... th year of medical education) on a specified day, during agreed lecture peri- ods, in April and May of 1999 (see Figure 2). All data were entered into an Acces...

Ngày tải lên: 18/06/2014, 17:20

... the training and its relevance to practice. This was comple- mented by participant observation and recording of com- ments during the training sessions, aiming at validating and refining the initial ... meant also to address continuity of care and patient-centeredness as characteristics of first line care. Practice management: the module aimed at making participants acquainte...

Ngày tải lên: 18/06/2014, 17:20

... physicians, the percentages of physicians working in rural areas and the average ages of physicians. The national population in these years was obtained by referring to the Japan Population Census and the ... cardiovascular surgery. Possible impact of changes in initial clinical training system Japan introduced a new clinical training system in 2004, and this will prob...

Ngày tải lên: 18/06/2014, 17:20

... satisfaction and motivation of health workers in public and private sectors: cross- sectional analysis from two Indian states David H Peters 1* , Subrata Chakraborty 2 , Prasanta Mahapatra 3 , Laura Steinhardt 1 Abstract Background: ... which was conducted by a separate organiza- tion. To obtain a list of private providers, the starting point was a database of facilitie...

Ngày tải lên: 18/06/2014, 17:20

... primers. ECD-forward: 5’ AAA CTC GAG ATG GAG CTG GCG GCC TTG T 3’ and reverse: 5’ CTT AAG CTT CGT CAG AGG GCT GGC TCT CT 3’ ;ICD-forward: 5’ AAACTCGAGAAGCGACGGCAGCAGAAG AT 3’ and reverse: 5’ CTT AAG CTT TCA ... Michael O Idowu 2 , Margaret M Grimes 2 , Laura Graham 3 , Maria-Libera Ascierto 4 , Ena Wang 4 , Xiang-Yang Wang 5 , Harry D Bear 3 and Masoud H Manjili 1* Abstract Background:...

Ngày tải lên: 18/06/2014, 19:20

... relating to low potency and cost. Peptide-based drug candidates are limited by insufficient efficacy and unfavorable phar- macokinetics. MAbs have increasingly gained favor in large part because ... OraSure Technologies, Inc. HIV/AIDS Market Cytolin CytoDyn Amerimmune Pharmaceuticals, Inc. HIV/AIDS I/II Tipranavir TIPRANAVIR HIV/AIDS III HXB AAI International, AnaaiPharma Company Her...

Ngày tải lên: 18/06/2014, 22:20

... A. Martin (Institut Pasteur, Paris, France). The primers used were VB1: 5¢-AAACATATGA GCATGAGCTACCACCTGGACC-3¢ and VB3: 5¢-CTCG AGCTTCACAAGAAACTTCTGC-3¢. The PCR fragment was cleaved by the restriction ... fragment contains two domains: domains I and II. Structures of both domain I (A) , as deter- mined by Schuster et al. [13] and by Smith et al. [14], and domain II, as deter...

Ngày tải lên: 20/02/2014, 01:20

... later, hemolymph was collected, and fat body RNA samples were prepared from each insect. (A) Antimicrobial activity of plasma assayed against E. coli, and identification of antimicrobial plasma ... protein-2 (betaGRP-2)from Manduca sexta; an acute-phase protein that binds beta-1,3-glucan and lipoteichoic acid to aggregate fungi and bacteria and stimulate prophenoloxidase activa-...

Ngày tải lên: 06/03/2014, 09:22