Báo cáo sinh học: "Electroporation increases antitumoral efficacy of the bcl-2 antisense G3139 and chemotherapy in a human melanoma xenograft" pot
Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx
... K A S Q KfK aKK NK H1.2 a- pSTAAAaKAKKA RaK pSS auK aK fK aKK NaK H1.3 a- STAAPaK pTKKK RaK pSS auK aK fK a KK NaK H1.4 a- STAAPaK pTKKA RaK pSS auK aK fK aKK NaK H1.5 a- pST A E P aK pSKKK RK TSaK ... dNK H103 a- A pTAAPA AK A K A K ATK KK 2m ⁄ fK 2mK dNK H11L a- STAPAA AK A K A K AT K KK 2m ⁄ fKK dNK H11R a- A pTA – A A A aKA K A K AT K KK 2m ⁄ fKK dNK H5 a- pT p...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Post-translational modification of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx
... enables visualization of extracellular and intracellular bacteria in the same cell [25]. The results concurred with the data from the gentamicin-based invasion assay. The ratio of intracellular ... of bacterial uptake once intracellular bacteria are present possibly com- bined with intracellular elimination. RhoA as well as Rac1 and Cdc42 are involved in modulating cyt...
Ngày tải lên: 16/02/2014, 15:20
Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc
... had an affinity, not for PE-containing membranes, but rather for anionic membranes contain- ing PG [16], and little information is available regard- ing the phospholipid and membrane binding of ... membrane binding of the carboxypeptidase Y inhibitor I C , a phosphatidylethanolamine-binding protein family member Joji Mima*, Hiroaki Fukada, Mitsuru Nagayama and Mitsuyoshi Ueda D...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Electron transfer chain reaction of the extracellular flavocytochrome cellobiose dehydrogenase from the basidiomycete Phanerochaete chrysosporium doc
... transfer chain reaction of CDH K. Igarashi et al. 2872 FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS 5¢-TCAGCGTTCTCGGAATTC-3¢; AP2-Xba-R, 5¢-TTTT ACAGTAATATAAAGAATTTCGCTCTAGATCAAGGA CCTCCCGCAAGCGCGAG-3¢; ... voltammetry was performed in the presence of 50 mm MgCl 2 using an ALS Electrochemical Analyzer 62 4A, and the potential was deter- mined by averaging the anodic and catho...
Ngày tải lên: 19/02/2014, 18:20
Tài liệu Báo cáo khoa học: Covalent binding to glutathione of the DNA-alkylating antitumor agent, S23906-1 doc
... for a further 5 min of mild agitation, and finally 200 lLof0.1 M EDTA, pH 7.5, was added and the mixture incubated for 4 h at 37 °C. After addition of 80 lLof5 M NaCl, the DNA was extracted using ... and at this stage we cannot eliminate the possibility that these glutathionyl conjugates remain capable of alkylating macromolecules and thus serve as a transport form and...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo khoa học: PRDM1/Blimp1 downregulates expression of germinal center genes LMO2 and HGAL pot
... CGTAG TG TAATG CATTTG AGA TTGATCCA-3¢ and 5¢-TGGATCAATCTCAAATGCATT ACACTACGAGCACGCGACCAGACTTAAAGCCTACC TTCTGTG-3¢ and for HGAL-mutant#2: 5¢-TATAAA AATTTGTACACACAGTCTTAGAGGACATACGTGTG TCGTGGCTAAATGCCTAGGAGTGAAATTGC-3¢ ... 5¢-GGAAAGAGCTC GAGTGACCAAACTGGAAACAAC-3¢ and HGAL-REV 5¢-GGGAAAGCTAGCT TGTGCTCTG ACAGGGCAAC-3 ¢. PCR products were digested with SacI and NheI (New England Biolabs, B...
Ngày tải lên: 05/03/2014, 23:20
Báo cáo khoa học: Two overlapping antiparallel genes encoding the iron regulator DmdR1 and the Adm proteins control sidephore and antibiotic biosynthesis in Streptomyces coelicolor A3(2) pdf
... ovalbumin) and pure DmdR1 revealed using antibodies against Adm (left panel) and antibodies against DmdR1 (right panel). Note the absence of Adm protein in both TAadm and DdmdR1 ⁄ adm, and the ... further experiments and named TAdmdR1 (strain in which translation was arrested in the sense strand of dmdR1) and TAadm (strain in which translation of the adm mRNA...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khoa học: Adenine nucleotides inhibit proliferation of the human lung adenocarcinoma cell line LXF-289 by activation of nuclear factor jB1 and mitogen-activated protein kinase pathways doc
... mitogen-acti- vated ⁄ extracellular signal-regulated protein kinase path- way and the Akt pathway. Cancer 104, 879–890. 26 Takada Y, Bhardwaj A, Potdar P & Aggarwal BB (2004) Nonsteroidal anti -in ammatory ... Recent advances indi- cate a number of links between the activation of p38 kinase and the DNA checkpoint pathways and their possible interaction in the modula...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx
... databases that would be indicative of a PMLA synthetase. Quantitative PCR revealed that polymalatase mRNA was expressed at considerably lower levels in amoebae and spherules than in plasmodia. ... dsRNA. Decreased levels of PMLA after microinjection of dsRNA PMLA was measured in the extracts of the above NKA48-dsRNA injected and control macroplasmodia harvested 24 h af...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Functionally active fusion protein of the novel composite cytokine CLC/soluble CNTF receptor pdf
... Murakami, M ., Hibi, M., Nakagawa, N., Nakagawa, T., Yasukawa,K.,Yamanishi,K.,Taga,T.&Kishimoto,T.(1993) IL-6-induced homodimerization of gp130 and associated a ctiva- tion of a tyrosine kinase. ... GRAB2/Sos adaptators and regulate the MAP kinase pathway [54–56]. ERK1 and ERK2, involved in the MAP kinase pathway, have been shown to play important roles in mediating...
Ngày tải lên: 08/03/2014, 10:20