... CCGGTG GTcGAcTTTGGTTtcACGCCC SalI E273Q ACGTACTGCTgTCCGGAA AGtACtCCATGGCCGC ScaI D353N TCCAATCCGTtAGTC TGgCCaTAGAACGCGC MscI E356Q GGAGAAT GGTgCCAGGGTACATTTcCAATCCGTCA KpnI D372N AATACAT CTTaAGGCCGTCGTtGTCGGTGTGG AflII D373N ... described in Materials and methods. Lower c ase letters indicate the nucleotide m utations. To facilitat e the selection of mutant clones, silent mutations were...
Ngày tải lên: 19/02/2014, 16:20
... (NUTRIM), Department of Human Biology, Maastricht University, the Netherlands Glutamine has an important function in the small intestine with respect to maintaining the gut epithelial barrier in ... intestinal cells obtain glutamine through exo- genous and endogenous routes. The exogenous gluta- mine comes from uptake of the amino acid itself or of glutamine-containing pepti...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx
... lysylhydroxylase II Sense: 5¢-GCACATTGGGAAACGCTA-3¢ Antisense: 5¢-AATTTTGCATTTGTGATC-3¢ Rat (gi: 6755107) lysylhydroxylase II Sense: 5¢-CCTGTTGTGCACATTGGG-3¢ Antisense: 5¢-AATTTTGCATTTGTGATC-3¢ Mouse (gi: 424103) ... II Sense: 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ Antisense: 5¢-GGAATTCCCAGTCTGTGTTCAACCG-3¢ Rat (gi: 6754969) prolylhydroxylase alpha II Sense: 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ Antisen...
Ngày tải lên: 20/02/2014, 02:21
Tài liệu Báo cáo Y học: Insights into the reaction mechanism of Escherichia coli agmatinase by site-directed mutagenesis and molecular modelling ppt
... 5¢-AT TAATGGCATGCTTTACCCGT-3¢.UsingthePCR products of agmatinase with the GfiAandC T substi- tutions in the coding and noncoding strands, respectively, and using the 5¢ and 3¢ primers mentioned above, the full length agmatinase ... same region of the arginases (Fig. 4). Since the arginase loop contains residues that interacts with the a-carboxylate group of the substrate arginin...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf
... phaiodotoxin supports the proposition of Froy and Gurevitz [38], that the C-terminal tail of the S cTXs are playing an important role in the biological activity of these toxins, and should constitute ... insect-toxin Bj’xtrIT from Butothus judaicus [35]. The insect toxin 1 from Androctonus australis (AshIT1) has 71 amino acids [36]. These t wo last toxins were described as i...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx
... f ij > 0 then we interpret that the node j activates the node i by increasing the net rate of x i and if f ij < 0 then the node j inhibits the node i. We note that the dynamics of the system in ... results in Figs 7 and 8). Sign equations for identification of the functional interaction structure In order to identify the true interaction structure through the sign of f...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc
... guanine nucleotide releasing protein ND – Rat IGF binding protein 5 ND – Rat FGF receptor activating protein 1 ND – Rat PKC delta-binding protein ND – Rat cellular retinoyl-binding protein ND ... catalyzes the first step of the b-oxidation in mitochondria. It is also possible that O-MACS is involved in the clearance of excess fatty acids taken into the supporting cells and cells...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo Y học: An active site homology model of phenylalanine ammonia-lyase from Petroselinum crispum docx
... substrate-free state of the enzyme as its conjugated acid (Fig. 7A,F), from which the amino group of the substrate can abstract a proton during entering into the active site (Fig. 7C). Interaction of the ... conclude that the mechanism involving the attack of MIO at the aromatic portion of the substrates is more consistent with the experimental data and modelling studies than...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx
... 5¢-CACCCAAGCTT GCCACCATGGAGGTTCAGCTGCAGCAGTCTG-3¢; primer 7, 5¢-GGT GGAGGAGGTTCTGATGTTTTGATGACCCAAACTCCAC-3¢; primer 8, 5¢-CGAAT GCGGCCGCCCGTTTGATTTCCAGCTTGGTGC-3¢; primer 9, 5¢-GGTGGAGGAGGTTCTGATGTTGTTCTGACCCAAACTCCACTC-3¢; primer ... 5¢-CGTCTCCTCAGGGGGTGGTGGTTCTGGAGGTGGAG GATCCGGTGGAGGAGGTTCT-3¢; primer 14, 5¢-CGTCTCCTCA GGGGGTGGTGGTTCTGGAGGTGGAGGATCCGGTGGAGGAGG TTCT-3¢. In all primers, u...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Multidrug efflux pumps: The structures of prokaryotic ATP-binding cassette transporter efflux pumps and implications for our understanding of eukaryotic P-glycoproteins and homologues ppt
... how is the extent of domain separation controlled? What are the attractive forces that bring the domains back into contact – is it possible that electrostatic attraction across a solvent- filled ... proximity to the ATP-binding sites [85,86]. The aromatic clusters within the ICLs of CFTR are almost certainly involved in effecting inter- domain communication between the NBDs and TMDs,...
Ngày tải lên: 22/03/2014, 21:20