báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACE Zf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACE Zf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACE Zffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCR Zffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... GTCCAGAATATTCAGCCTTTCACC 3¢-RACE Zftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCR Zftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCR Zf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACE Zf3¢ tbet...

Ngày tải lên: 16/02/2014, 09:20

20 690 0
Tài liệu Báo cáo khoa học: SREBPs: physiology and pathophysiology of the SREBP family ppt

Tài liệu Báo cáo khoa học: SREBPs: physiology and pathophysiology of the SREBP family ppt

... reductase SREBP-2 NADPH Pyruvate Acetyl-CoA Citrate acetyl-CoA Oxaloacetate Oxaloacetate ACL ACC HMG-CoA HMG-CoA synthase Citrate Malonyl-CoA Palmitate Malate Mitochondria FAS ACC SCD Fatty acid ... Endo Y, Ishikawa M, Matsuzaka T, Nakagawa Y, Kumadaki S, Yahagi N et al. (2006) Granuphilin is activated by SREBP-1c and involved in impaired insulin secretion in diabetic mice. Cell Metab 4...

Ngày tải lên: 18/02/2014, 13:20

6 574 1
Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

... from the evolution of this family. Evolution based on domain reusing might explain the abundance of certain protein domains and is a way of easily increasing the number of TFs, as appears to have ... T, Maruy- ama M, Saito M, Yamada M, Takahashi H & Tsuji S (1999) A neurological disease caused by an expanded CAG trinucleotide repeat in the TATA-binding protein gene...

Ngày tải lên: 19/02/2014, 07:20

12 511 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

... amount of radioactivity incorporated into the nucleic acids was measured after TCA precipitation and plotted against the incubation time in minutes. T. Astier-Gin et al. Binding and replication of ... a minus-strand RNA that serves as a template for the synthesis of new plus-strand RNA molecules. Initiation of RNA synthesis at the 3¢-end of the plus- and minus-...

Ngày tải lên: 20/02/2014, 01:20

15 598 0
Tài liệu Báo cáo Y học: Phosphatidylinositol synthesis and exchange of the inositol head are catalysed by the single phosphatidylinositol synthase 1 from Arabidopsis docx

Tài liệu Báo cáo Y học: Phosphatidylinositol synthesis and exchange of the inositol head are catalysed by the single phosphatidylinositol synthase 1 from Arabidopsis docx

... 2002 Effect of EDTA as a function of the concentration in free manganese ions Theconcentrationoffreemanganeseionswascalculatedat each EDTA concentration using an apparent EDTA stability constant K 1 of ... and partial characterization of CDP-diacylglycerol: inositol transferase and myo-inositol exchange reactions. Quadrennial Joint Meetings of the American Society of P...

Ngày tải lên: 22/02/2014, 04:20

6 552 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

... temperature in SOC medium and then plated on Luria–Bertani agar plates containing kanamycin. Kanamycin resistant (Km R )trans- formants were selected and colony-purified on agar plates incubated ... to estimate the ratio between the amounts of UP12 and the total amount of protein in the extracts, a series of samples containing determined amounts of the purified UP1...

Ngày tải lên: 22/02/2014, 07:20

9 548 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

... form of proHP8 Xa and the catalytic domain of active HP8 are marked with arrowheads. The size and position of molecular weight stan- dards are indicated on the left. (B) The catalytic activity of ... 155 Diptera, Coleoptera, and Lepidoptera, there are inter- esting variations in how the pathways are initiated by recognition of microbial patterns and by microbia...

Ngày tải lên: 06/03/2014, 09:22

15 541 0
Báo cáo khoa học: Purification and characterization of the cysteine proteinases in the latex of Vasconcellea spp. ppt

Báo cáo khoa học: Purification and characterization of the cysteine proteinases in the latex of Vasconcellea spp. ppt

... translation showed that they hold the characteristic features of all known papain-class cysteine proteinases, and a phylogenetic analysis revealed the existence of several papain and chymopapain ... VXH-D, and from that of V. stipulata: VS -A and VS-B. The amino acid sequence of all six cDNA-sequences was deduced in silico and analyzed. A detailed comparison was...

Ngày tải lên: 07/03/2014, 11:20

12 525 0
Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt

Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt

... superfamily, such as the absence of the exon encoding the KPI domain and the lack of a second heparin-binding domain [3,4,13,26]. Comparative analysis of the Xenopus and mammalian APLP2 proteins Comparing ... duplication in the preAPLP family may have resulted in the appearance of the APLP1 and APLP2 gene families. The fact that both mammals and Xenopus...

Ngày tải lên: 16/03/2014, 16:20

7 406 0
Báo cáo khoa học: Structure, expression and regulation of the cannabinoid receptor gene (CB1 ) in Huntington’s disease transgenic mice ppt

Báo cáo khoa học: Structure, expression and regulation of the cannabinoid receptor gene (CB1 ) in Huntington’s disease transgenic mice ppt

... It appeared that the amino t erminus of mutant huntingtin containing an expan- ded polyglutamine tract caused the steady-state CB1 mRNA levels in the lateral striatum to decrease between 3 and ... neuro- degeneration of a subpopulation of cells in the basal ganglia. In addition, a reduction in the level of normal huntingtin may also be detrimental to the surv...

Ngày tải lên: 16/03/2014, 18:20

12 504 0
w