Báo cáo sinh học: " Role of CD151, A tetraspanin, in porcine reproductive and respiratory syndrome virus infection" pdf

... Jeong-Ki.Kim@STJUDE.ORG; Sanjay Kapil* - sanjay.kapil@okstate.edu * Corresponding author Abstract Background: Porcine reproductive and respiratory syndrome virus (PRRSV) is a RNA virus causing respiratory and reproductive ... complexes that also withstands immunpre- RNA-binding activity of CD151 in vitro and in vivoFigure 2 RNA-binding activity of CD151 in v...

Ngày tải lên: 18/06/2014, 18:20

... USA Email: Vasudha Sundaravaradan - vsvaradan@yahoo.com; Suman R Das - dassr@niaid.nih.gov; Rajesh Ramakrishnan - ramakris@bcm.tmc.edu; Shobha Sehgal - sehgal@hotmail.com; Sarla Gopalan - Gopalan@hotmail.com; ... 20:115-121. 39. Ramalingam S, Kannangai R, Vijayakumar TS, Subramanian S, Abraham OC, Rupali P, Jesudason MV, Sridharan G: Increased number of CCR5+ CD4 T cells among south Indian...

Ngày tải lên: 18/06/2014, 18:20

... group. Functional parameters Animals were placed in individual metabolic cages for blood and urine collection. Functional parameters were measured using an automatic analyzer (Modular auto- matic analyzer, ... briefly, NAG activity was determined on a Roche Modular P system (Roche Di agnostics, Meylan, France) and AAP determination was mea sured using storage method and colorimetric...

Ngày tải lên: 18/06/2014, 19:20

... G, Rahman A, Chen G, Staten A, Griebel D, Pazdur R: Approval summary: imatinib mesylate in the treatment of metastatic and/ or unresectable malignant gastrointestinal stromal tumors. Clin Cancer ... Clin Oncol 2006, 24:816-822. 23. Andrade CR, Takahama Junior A, Nishimoto IN, Kowalski LP, Lopes MA: Rhabdomyosarcoma of the head and neck: a clinicopathological and immunohistoch...

Ngày tải lên: 18/06/2014, 19:20

... Funahashi T, Tanaka S, Hotta K, Matsuzawa Y, Pratley RE, Tataranni PA. Hypoadiponectinemia in obesity and type 2 diabetes: close association with insulin resistance and hyperin- sulinemia. ... protein-fed and soy protein-fed animals may be due to decreased pancreatic insulin release and/ or increased hepatic insulin removal. Recently, Davis et al evaluated effects of casein an...

Ngày tải lên: 31/10/2012, 14:59

... determination, enzyme assays and materials CT -A and CT-B, native CT, acridine orange and pepsta- tin A were purchased from Sigma (St Louis, MO, USA). A nontoxic diphtheria toxin CRM 197 mutant and bafilomy- cin -A1 ... compartmentalization and cytotoxic action of cholera toxin in rat liver parenchyma. Following administration of a saturating dose of cholera toxin to r...

Ngày tải lên: 19/02/2014, 02:20

... E301 in Anabaena FNR) is displaced towards S96 (S80), bringing both side-chains into H-bonding distance [9]. In the Anabaena complex, changes are observed in the relative distances and organization between ... balance equation and two Beer’s law relationships (458 and 600 nm). Our data indicate that although wild-type, K75E and E139K FNRs accumulate a maximum of 22, 27 and...

Ngày tải lên: 08/03/2014, 23:20

... studies have ques- tioned whether lipase activation is even interfacial in the presence of bile salt and colipase, on the basis of attaining an activated ternary complex of PL, colipase and a small ... structural domains: a large N-terminal domain, which contains the active site with the catalytic triad formed by Ser152, Asp176 and His263, and a smaller C-terminal domain...

Ngày tải lên: 16/03/2014, 06:20

... 5¢-GCCCTCGAGAAAAGATC TAGAACTGGAGCTTACGGAG-3¢ for C 4A, 5¢-CAAA AGCTTTCTGTCGATCCAGC-3¢ for C60S, 5¢-CAAAAG CTTGCTGTCGATCCAGC-3¢ for C6 0A, 5¢-TCTTCTAA GTCTGCTAAGCCAGAAAAGCTGAACTACTCT GGA GTTG-3¢ ... lysozyme Shunsuke Kawamura 1 , Mari Ohkuma 1 , Yuki Chijiiwa 1 , Daiki Kohno 1 , Hiroyuki Nakagawa 1 , Hideki Hirakawa 2 , Satoru Kuhara 2,3 and Takao Torikata 1 1 Department of Bioscience, Sch...

Ngày tải lên: 16/03/2014, 06:20