Báo cáo sinh học: " Role of CD151, A tetraspanin, in porcine reproductive and respiratory syndrome virus infection" pdf
Báo cáo sinh học: " Role of CD151, A tetraspanin, in porcine reproductive and respiratory syndrome virus infection" pdf
... Jeong-Ki.Kim@STJUDE.ORG; Sanjay Kapil* - sanjay.kapil@okstate.edu
* Corresponding author
Abstract
Background: Porcine reproductive and respiratory syndrome virus (PRRSV) is a RNA virus
causing respiratory and reproductive ... complexes that also withstands immunpre-
RNA-binding activity of CD151 in vitro and in vivoFigure 2
RNA-binding activity of CD151 in v...
Báo cáo sinh học: " Role of HIV-1 subtype C envelope V3 to V5 regions in viral entry, coreceptor utilization and replication efficiency in primary T-lymphocytes and monocyte-derived macrophages" docx
... USA
Email: Vasudha Sundaravaradan - vsvaradan@yahoo.com; Suman R Das - dassr@niaid.nih.gov; Rajesh Ramakrishnan - ramakris@bcm.tmc.edu;
Shobha Sehgal - sehgal@hotmail.com; Sarla Gopalan - Gopalan@hotmail.com; ... 20:115-121.
39. Ramalingam S, Kannangai R, Vijayakumar TS, Subramanian S, Abraham
OC, Rupali P, Jesudason MV, Sridharan G: Increased number of
CCR5+ CD4 T cells among south Indian...
Báo cáo sinh học: " Analysis of machine perfusion benefits in kidney grafts: a preclinical study" doc
... group.
Functional parameters
Animals were placed in individual metabolic cages for
blood and urine collection. Functional parameters were
measured using an automatic analyzer (Modular auto-
matic analyzer, ... briefly, NAG activity was determined on
a Roche Modular P system (Roche Di agnostics, Meylan,
France) and AAP determination was mea sured using
storage method and colorimetric...
Báo cáo sinh học: " Inhibition of phosphorylated c-Met in rhabdomyosarcoma cell lines by a small molecule inhibitor SU11274" pdf
... G,
Rahman A, Chen G, Staten A, Griebel D, Pazdur R: Approval summary:
imatinib mesylate in the treatment of metastatic and/ or unresectable
malignant gastrointestinal stromal tumors. Clin Cancer ... Clin
Oncol 2006, 24:816-822.
23. Andrade CR, Takahama Junior A, Nishimoto IN, Kowalski LP, Lopes MA:
Rhabdomyosarcoma of the head and neck: a clinicopathological and
immunohistoch...
Báo cáo y học: " Role of Dietary Soy Protein in Obesity"
... Funahashi T, Tanaka S, Hotta K, Matsuzawa Y, Pratley
RE, Tataranni PA. Hypoadiponectinemia in obesity and type 2
diabetes: close association with insulin resistance and hyperin-
sulinemia. ... protein-fed and soy protein-fed animals
may be due to decreased pancreatic insulin release
and/ or increased hepatic insulin removal. Recently,
Davis et al evaluated effects of casein an...
Tài liệu Báo cáo khoa học: Role of receptor-mediated endocytosis, endosomal acidification and cathepsin D in cholera toxin cytotoxicity pdf
... determination,
enzyme assays and materials
CT -A and CT-B, native CT, acridine orange and pepsta-
tin A were purchased from Sigma (St Louis, MO, USA). A
nontoxic diphtheria toxin CRM 197 mutant and bafilomy-
cin -A1 ... compartmentalization and cytotoxic action of cholera toxin in
rat liver parenchyma. Following administration of a saturating dose of
cholera toxin to r...
Báo cáo Y học: Role of critical charged residues in reduction potential modulation of ferredoxin-NADP+ reductase Differential stabilization of FAD redox forms doc
... E301 in Anabaena FNR) is
displaced towards S96 (S80), bringing both side-chains into
H-bonding distance [9]. In the Anabaena complex, changes
are observed in the relative distances and organization
between ... balance
equation and two Beer’s law relationships (458 and
600 nm). Our data indicate that although wild-type, K75E
and E139K FNRs accumulate a maximum of 22, 27 and...
Báo cáo khoa học: Role of the structural domains in the functional properties of pancreatic lipase-related protein 2 pot
... studies have ques-
tioned whether lipase activation is even interfacial in
the presence of bile salt and colipase, on the basis of
attaining an activated ternary complex of PL, colipase
and a small ... structural domains: a large N-terminal domain,
which contains the active site with the catalytic triad
formed by Ser152, Asp176 and His263, and a smaller
C-terminal domain...
Báo cáo khoa học: Role of disulfide bonds in goose-type lysozyme potx
... 5¢-GCCCTCGAGAAAAGATC
TAGAACTGGAGCTTACGGAG-3¢ for C 4A, 5¢-CAAA
AGCTTTCTGTCGATCCAGC-3¢ for C60S, 5¢-CAAAAG
CTTGCTGTCGATCCAGC-3¢ for C6 0A, 5¢-TCTTCTAA
GTCTGCTAAGCCAGAAAAGCTGAACTACTCT GGA
GTTG-3¢ ... lysozyme
Shunsuke Kawamura
1
, Mari Ohkuma
1
, Yuki Chijiiwa
1
, Daiki Kohno
1
, Hiroyuki Nakagawa
1
, Hideki
Hirakawa
2
, Satoru Kuhara
2,3
and Takao Torikata
1
1 Department of Bioscience, Sch...