báo cáo sinh học:" A cost-effectiveness study of caesarean-section deliveries by clinical officers, general practitioners and obstetricians in Burkina Faso" doc

Báo cáo y học: "A pilot study of rizatriptan and visually-induced motion sickness in migraineu"

Báo cáo y học: "A pilot study of rizatriptan and visually-induced motion sickness in migraineu"

... study, using a small number of subjects, we addressed the hypotheses that rizatriptan acts as a protective agent against visually-induced motion sickness in migraineurs and that rizatriptan ... trial was conducted in accordance with the guidelines of the International Conference on Har- monization for Good Clinical Practice and the study protocol was approved by a...

Ngày tải lên: 26/10/2012, 09:57

6 504 0
Báo cáo y học: "A Randomized Study of Epithelial Ovarian Cancer: Is Chemotherapy Useful after Complete Remission"

Báo cáo y học: "A Randomized Study of Epithelial Ovarian Cancer: Is Chemotherapy Useful after Complete Remission"

... al. Impact of Adjuvant Chemotherapy and Surgical Staging in Early- Stage Ovarian Carcinoma: European Organisation for Research and Treatment of Cancer–Adjuvant ChemoTherapy in Ovarian Neoplasm ... Venkatraman ES, et al. A phase II trial of intraperitoneal cisplatin and etoposide as consolidation therapy in patients with stage II-IV epithelial ovarian cancer following neg...

Ngày tải lên: 03/11/2012, 09:57

10 420 0
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

... 465-472. Andrew, G. and Gao, J. 2007. Scalable training of L 1 -regularized log-linear models. In ICML. Charniak, E. 2000. A maximum-entropy-inspired parser. In NAACL, 132-139. Charniak, E. and ... epochs, and N is the number of training samples. 3 Evaluations From the four tasks we consider, parsing and lan- guage model adaptation are both examples of re-ranking...

Ngày tải lên: 08/03/2014, 02:21

8 505 0
Báo cáo khoa học: A kinetic study of sugarcane sucrose synthase pdf

Báo cáo khoa học: A kinetic study of sugarcane sucrose synthase pdf

... metabolism [9] and further examples of its application are given therein, as well as practical advice on isolation and assay of plant enzymes and extraction of metabolites. It should be mentioned that plants ... on individual enzymes immensely and can have both explanatory and predictive value. Several papers that give a n overview of different approa- ches for studying a...

Ngày tải lên: 16/03/2014, 18:20

7 414 0
Báo cáo khoa học: "A Pilot Study of Opinion Summarization in Conversations" docx

Báo cáo khoa học: "A Pilot Study of Opinion Summarization in Conversations" docx

... contains opinion. To obtain this, we trained a maximum entropy classifier with a bag -of- words model using a combination of data sets from several domains, including movie data (Pang and Lee, 2004), ... Philadelphia. Andrew Hayes and Klaus Krippendorff. 2007. Answer- ing the call for a standard reliability measure for cod- ing data. Journal of Communication Methods and Measu...

Ngày tải lên: 17/03/2014, 00:20

9 442 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

... Micciulla, and J. Makhoul. 2006. A study of translation edit rate with targeted human annotation. In Proceeding of AMTA. T. Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. ... Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the real world. In Proceeding of LREC-2002, Las Palmas de Gran Canaria, Spain...

Ngày tải lên: 17/03/2014, 01:20

8 547 1
Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf

Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf

... on Dialogue Management Alexandros Papangelis NCSR ”Demokritos”, Institute of Informatics & Telecommunications and Univ. of Texas at Arlington, Comp. Science and Engineering alexandros.papangelis@mavs.uta.edu Abstract Adaptive ... years ADS have seen a lot of progress and have attracted the research community’s and industry’s interest. There is a number of available ADS...

Ngày tải lên: 17/03/2014, 22:20

10 499 0
Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

... (Tc00.1047053510659.240) was amplified by PCR from genomic DNA using the sense pri- mer 5¢-AAGCTTATGTCAACACGACGACTTATGCAC A- 3¢ and the antisense primer 5¢-GGATCCGGATCCTT AAGCCGTTCCCTGTTC-3¢ with additional HindIII and BamHI ... not maintain an intact glyoxalase system, and may metabolize methylglyoxal via methylgly- oxal reductase (MeGR) and lactaldehyde dehydrogenase (LADH) to L-l...

Ngày tải lên: 23/03/2014, 06:20

11 640 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

... ATATAT CATATGTCCGGTGTCGCAAAG R-TryX ATATA GGATCCTTACTCGTCTCTCCACGG F-TryP1 ATATAT CATATGTCCTGCGGTAACGCC R-TryP1 ATATA GGATCCTTACTGCTTGCTGAAGTATC F-TDPX1 Cys35Ala CAACGTAGCCAGCAAG GCCGGCTTCACCAAGGGCG R-TDPX1 Cys35Ala ... codons of the mutated amino acids are in bold. Cloned protein or mutation primer (5’- to 3’) F-TDPX1 TATAT CATATGTCTATCTACGACTTCAAGGTC R-TDPX1 ATATA GGATCCTCACGATTGAGTGCTT...

Ngày tải lên: 23/03/2014, 07:20

16 484 0
Báo cáo khoa học: A spectroscopic study of the interaction of isoflavones with human serum albumin pdf

Báo cáo khoa học: A spectroscopic study of the interaction of isoflavones with human serum albumin pdf

... the binding site of HSA has space and appropriate shape and residues to accommodate both warfarin and geni- stein. A crystal structure of HSA bound to warfarin is available (PDB no. 1h9z and 1 ha2) ... experimental findings and support the idea of simultaneous binding of warfarin and genistein in HSA. Experimental procedures Materials Human serum albumin (A- 1653), BSA...

Ngày tải lên: 23/03/2014, 11:20

17 457 0
w