microsomal epoxide hydrolase gene is a novel endogenous protectant against beta amyloid (1-42)-induced cognitive impairments in mice

microsomal epoxide hydrolase gene is a novel endogenous protectant against beta amyloid (1-42)-induced cognitive impairments in mice

microsomal epoxide hydrolase gene is a novel endogenous protectant against beta amyloid (1-42)-induced cognitive impairments in mice

... novel endogenous protectant against beta amyloid (1-42)-induced cognitive impairments in mice Ngo Thi Ngoc Yen Department of Pharmacy Graduate School, Kangwon National University Abstract Microsomal ... dementia. Choline acetyltransferase and glutamic acid decarboxylase activities in necropsy brain tissue Reeta, K.H.; Mehla, J.; Gupta, Y.K. Curcumin is pro...

Ngày tải lên: 12/06/2014, 15:50

54 169 0
Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt

Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt

... shRNA knockdown The HepG2 human liver carcinoma cell line, MIA PaCa-2 human pancreatic carcinoma cell line and the human ade- nocarcinoma colorectal cell lines DLD1, T84 and Colo205 were all obtained ... sequence in rat, mouse and human CUX1 was kindly provided by Dr Julian Downward [50]. Two bases (in capitals) were further mutated (5¢-aagaaga acaGAccagaggattt-3¢) to be used as a contro...

Ngày tải lên: 29/03/2014, 21:20

13 359 0
Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx

Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx

... from mammals and insects in order to iso- latethegene.The1597bpputativecDNAofD. melano- gaster microsomal EH (DmEH) obtained from a larval cDNA library encoded 463 amino acids in an open reading frame. ... DIG Labelling Mix (Roche). To prepare a DmEH probe, primers (5¢-ATGGCGAAC ATCTGGCCACGAATC-3¢ and 5¢-TTATGAGAAATT GGCTTTCTGGAC-3¢) were used, and to prepare Actin 5C probe as an in...

Ngày tải lên: 07/03/2014, 21:20

10 379 0
Báo cáo khoa học: S -Stereoselective piperazine-2-tert-butylcarboxamide hydrolase from Pseudomonas azotoformans IAM 1603 is a novel L-amino acid amidase doc

Báo cáo khoa học: S -Stereoselective piperazine-2-tert-butylcarboxamide hydrolase from Pseudomonas azotoformans IAM 1603 is a novel L-amino acid amidase doc

... sequence ranging from 1632 to 1654. The two primers were as follows: sense primer, 5¢-CGATCC AAGCTTTAAGGAGG AAtagGAAATGGAATTCATCGAAAAAATCCG-3¢ antisense primer, 5¢-TGCATCCA TCTAGAGCATTCA GC-3¢. The amplified ... Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory, Cold Spring Harbor N.Y. 22. Misawa, N., Nakagawa, M., Kobayashi, K., Yamano, S., Izawa, Y., Nakamura,...

Ngày tải lên: 23/03/2014, 12:20

11 283 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

... spinal cord tissue sections were treated with an antibody against Vgf (rabbit anti rat monoclonal D20, 1:1000, Santa Cruz, CA) or against SMI-32 (rabbit polyclonal, 1:200 dilution; Santa ... Acad Sci USA 2006; 103(39): 14584-14589. 16. Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N....

Ngày tải lên: 03/11/2012, 10:52

8 503 0
Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc

Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc

... Ac-DEVD-AMC is a substrate for caspases 3 and 7; Ac-YVAD-AMC is a substrate for caspase 1; Ac-IETD-AMC is a substrate for caspase 8 and 10; Ac-LEHD-AMC is a substrate for caspases 2, 4, 5 and 9. Ac-DVPD-AMC, ... apoptosis is induced. In contrast, cleavage of the p27 KIP1 DPSD-AMC substrate remained constant under these assay conditions. Thus it appears that KIPase maintain...

Ngày tải lên: 19/02/2014, 13:20

8 443 0
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx

Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx

... homologs are poly (A) polymerases. Proc Natl Acad Sci USA 101, 4407–4412. 18 Nakanishi T, Kubota H, Ishibashi N, Kumagai S, Watanabe H, Yamashita M, Kashiwabara S, Miyado K & Baba T (2006) ... glycine-rich (RGG) motifs that are characteristic of RNA-binding proteins, and an alanine-rich carboxy-terminal sequence that could be involved in protein–protein interactions. Interestingly, thi...

Ngày tải lên: 07/03/2014, 05:20

14 502 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

... amplified from plasmid pUG27 as described above using the primers disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢. ... plasmid pUG27 [13] using the primers disSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TA...

Ngày tải lên: 07/03/2014, 15:20

8 485 0
Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

... transvacuolar strands and maintain overall cellular architecture. As mentioned above, CRP1 may participate in the formation and ⁄ or maintenance of long actin cables [12]. Consistent with this ... [17]. FHL3 reg- ulates a- actinin-mediated actin bundling as an actin- binding protein [18]. CRP3 (also called muscle LIM protein–MLP) plays an important role in myogenesis and in the promoti...

Ngày tải lên: 16/03/2014, 06:20

11 347 0
Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx

Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx

... 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and 5¢-CA CGCAGCTCATTGTAGAAGG-3¢. Another primer pair used for SerpinA3 was ACTas5-ACTas3: 5¢-GAATCC ACCAGCTACATCCA-3¢ and 5¢-GTGCCCTCCTCAAA TACATCA-3¢. Western blot assay The cells ... pcDNA3.1-GST-Nur77 plasmid. pSilencer-shNur77 was prepared by overlapping strategy with primers 5¢-gacGGATCCgcagtccagccatgctccttt caagagaaggagcatg-3¢ (with BamHI), 5¢-cggAAGCTTtATC...

Ngày tải lên: 23/03/2014, 07:20

14 397 0
w