univ of minnesota press mechademia 3 limits of the human nov 2008

Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx

Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx

... iron- loaded HepG2 cells FEBS Journal 272 (2005) 152–165 ª 2004 FEBS 163 Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading Marisa Cabrita 1, *, ... intra- cellular lipids regulate expression of CD1d at the cell surface, we examined parameters of lipid metabolism in iron-...

Ngày tải lên: 19/02/2014, 16:20

14 683 0
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc

Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc

... RT-PCR using total RNA separated from mix stage of C. elegans as a template with the following primers: M2- goa1-s, 5¢- CATTATAAGA ACATAGGCGCTACAAGGATGGGTTGTACCATGTC ACAGGAAG-3¢; M2- goa1-PstI-as, ... M 2 in the GOA-1 fusion protein is functional, and the ligand-binding properties agree with that of the Ga i1 fusion protein. Activation of GOA-1 by muscarinic...

Ngày tải lên: 07/03/2014, 11:20

9 400 0
edinburgh university press blasphemies of thomas aikenhead boundaries of belief on the eve of the enlightenment nov 2008

edinburgh university press blasphemies of thomas aikenhead boundaries of belief on the eve of the enlightenment nov 2008

... So the king’s (and Portland’s) real advisers on Scotland were The Blasphemies of Thomas Aikenhead Boundaries of Belief on the Eve of the Enlightenment Michael F. Graham Edinburgh University Press 24 ... were managed on the king’s behalf by others, and they were at times difficult to control, particularly since one of the changes of 1689–90 had...

Ngày tải lên: 11/06/2014, 12:44

193 295 0
university of california press losing face status politics in japan nov 1992

university of california press losing face status politics in japan nov 1992

... practice of overlooking legalisms and of resorting instead to informal understandings is widespread—clearly makes the process of incorporating new abstract principles into the domain of everyday ... Impact of Environmental Protest in Japan, " in Political Opposition and Local Politics in Japan, ed. Kurt Steiner, Ellis S. Krauss, and Scott C. Flanagan (Princeton: P...

Ngày tải lên: 11/06/2014, 12:46

274 564 0
university of california press vocal tracks performance and sound media aug 2008

university of california press vocal tracks performance and sound media aug 2008

... Angeles, California University of California Press, Ltd. London, England © 2008 by The Regents of the University of California An earlier version of chapter 2 appeared as “Filling the Embarrassment of ... intersection of the voice, sound media tech- nologies, and performance, I draw on a variety of scholarly work. Much of the analysis of sound recording...

Ngày tải lên: 11/06/2014, 12:46

304 728 0
university of minnesota press high techne art and technology from the machine aesthetic to the posthuman nov 1999

university of minnesota press high techne art and technology from the machine aesthetic to the posthuman nov 1999

... relevant—in the emergence of high tech out of modernist technological aesthetics. Throughout the book, in fact, the issue of how these changes in the conception of technology and the aesthetic took ... practitioner of the black arts. Thus, the pri- mal scene of Kantian, romantic aesthetics would be precisely this birth of the machine, the bringing to...

Ngày tải lên: 11/06/2014, 12:49

204 356 0
the university of north carolina press fall-out shelters for the human spirit american art and the cold war jun 2005

the university of north carolina press fall-out shelters for the human spirit american art and the cold war jun 2005

... Americans thought of paintings as ‘‘only works of art. ’’ That did not hold true in 1941. ‘‘Today they are the symbols of the human spirit and of the world the freedom of the human spirit made—a world ... SPIRIT American Art and the Cold War michael l. krenn the university of north carolina press chapel hill and london 36 ADVANCING A...

Ngày tải lên: 11/06/2014, 13:00

313 445 0
university of california press a critical history of early rome from prehistory to the first punic war feb 2005

university of california press a critical history of early rome from prehistory to the first punic war feb 2005

... making tools, utensils, and weapons. Metal- working and the exchange of manufactured metal objects are clearly 22 italy in prehistory A Critical History of Early Rome From Prehistory to the First ... empties into the Adriatic. Since the land nearest the Po was often marshy, the earli- est human inhabitants of northern Italy tended to settle in areas awa...

Ngày tải lên: 11/06/2014, 13:04

421 379 0
university of minnesota press revolution televised prime time and the struggle for black power oct 2004

university of minnesota press revolution televised prime time and the struggle for black power oct 2004

... Revolution Televised Prime Time and the Struggle for Black Power Christine Acham University of Minnesota Press Minneapolis / London ix Acknowledgments Revolution Televised: Prime Time and the ... for segregated black audiences established venues for professional black performers and the development and expres- sion of black humor. By...

Ngày tải lên: 11/06/2014, 13:07

256 421 0
univ of minnesota press when species meet dec 2007

univ of minnesota press when species meet dec 2007

... endemic to the history of both biology and the nation; the col- lision of endangered species worlds, with their conservation apparatuses, WHEN SPECIES MEET d 37 14 d WHEN SPECIES MEET Faye Ginsburg ... richer web to inhabit than any of the posthumanisms 16 d WHEN SPECIES MEET 1. WHEN SPECIES MEET Introductions Two questions guide this book: () Whom and what do...

Ngày tải lên: 11/06/2014, 13:53

438 343 0
university of iowa press twelve millennia archaeology of the upper mississippi river valley may 2003

university of iowa press twelve millennia archaeology of the upper mississippi river valley may 2003

... system occurs at the mouth of the Zumbro River, where environment | 27 2.6. The Driftless Area in relation to the Upper Mississippi River. For the people of the Upper Mississippi Valley, past ... Index viii | contents Environment of the Upper Mississippi River Valley The portion of the Upper Mississippi River that cuts through the unglaci...

Ngày tải lên: 11/06/2014, 14:35

273 202 0
univ of minnesota press french colonial documentary mythologies of humanitarianism mar 2008

univ of minnesota press french colonial documentary mythologies of humanitarianism mar 2008

... Introduction Introduction: French Colonial Documentary vii 1. Tupi or Not Tupi: Natural Man and the Ideology of French Colonial Documentary 1 2. Mythologies of the Tirailleurs Sénégalais: Cinema, Shell Shock, and French ... August–September 2001, Dernier Cri, Marseille, France. Courtesy of Reinhard Scheibner. Copyright 2008 by the Regents of the University of Min...

Ngày tải lên: 11/06/2014, 15:44

281 261 0
univ of minnesota press mechademia 3 limits of the human nov 2008

univ of minnesota press mechademia 3 limits of the human nov 2008

... as a kind of coexistence in which the human and inhuman   xiii the notion of the monstrous, a space that defi nes the contours of the human by lying on the other side of some perceived ... hand, just on the other side of history, beneath the map, around the corner, through the television screen.  ese otherworlds of Mizuki Shigeru expand th...

Ngày tải lên: 11/06/2014, 15:46

304 325 0
university of minnesota press 50 circuit hikes a stride-by-stride guide to northeastern minnesota mar 2002

university of minnesota press 50 circuit hikes a stride-by-stride guide to northeastern minnesota mar 2002

... away a man alive .The rain Saturday evening and the Sabbath, has rendered the portage almost impassable for man and beast. The mud, for the most part of the way, will average ankle ... stops, or pauses, located about a half-mile apart. There were thirteen pauses along the Savanna Portage Trail. After carrying a load from one pause to the next, a vo...

Ngày tải lên: 11/06/2014, 17:08

241 405 0
Báo cáo y học: "Physical function, disease activity, and health-related quality-of-life outcomes after 3 years of adalimumab treatment in patients with ankylosing spondylitis" potx

Báo cáo y học: "Physical function, disease activity, and health-related quality-of-life outcomes after 3 years of adalimumab treatment in patients with ankylosing spondylitis" potx

... Safety and efficacy of readministration of infliximab after longterm continuous therapy and withdrawal in patients with ankylosing spondylitis. J Rheumatol 2007, 34 :510-515. 25. Baraliakos X, Brandt ... JC: Adalimumab reduces pain, fatigue, and stiffness in patients with ankylosing spondylitis: results from the Adalimumab Trial Evaluating Long-Term Safety an...

Ngày tải lên: 09/08/2014, 14:22

12 595 0
Từ khóa:
w