A novel matrix converter topology with simple commutation
A novel matrix converter topology with simple commutation
... paper discloses a novel matrix topology with advantages over the usual matrix converter topology. Firstly, it has the same performance as a conventional matrix converter in terms of voltage ... following advantages: • It has the same performance as the conventional matrix converter, such as good voltage transfer ratio capacity, four quadrant operation, unity inpu...
Ngày tải lên: 13/05/2014, 00:55
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... M, Hasegawa K, Horita C & Akera S (1999) A new matrix protein family related to the nacreous layer formation of Pinctada fucata. FEBS Lett 462, 225–229. 5 Kono M, Hayashi N & Samata T ... region was decreased and a new band was detected at 64 kDa, but only after treatment with heparitinase II (Fig. 5A) . Although the same band was obtained after digestion Fig. 3. 45 Ca overlay...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: A novel dicyclodextrinyl diselenide compound with glutathione peroxidase activity ppt
... CumOOH, and NADPH were also obtained from Sigma. Sephadex G-25 was pur- chased from Pharmacia (Uppsala, Sweden). All the other materials were of analytical grade and obtained from Beijing Chemical ... experi- ment carried out without the mimic, ascorbate, and ferrous sulfate was known as the control group. Biological analysis of mimics against mitochondrial damage Mitochondrial swelling was a...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx
... cross-react with antibodies against plant helicases including PDH45 and PDH65 and also against human DNA helicases I, II, III and IV (data not shown). ssDNA-dependent ATPase activity was present at a ... HDH, human DNA helicase; eIF-4 A, eukaryotic translation initiation factor 4A. Property PDH45 a PDH65 b PDH120 Molecular mass: SDS/PAGE 45.5 kDa 65 kDa 54 and 66 kDa Native 45.5 kDa 6...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo khoa học: A novel mannitol teichoic acid with side phosphate groups ofBrevibacterium sp.VKM Ac-2118 ppt
... A novel mannitol teichoic acid with side phosphate groups of Brevibacterium sp. VKM Ac-2118 Natalia V. Potekhina 1 , Alexander S. Shashkov 2 , Lyudmila I. Evtushenko 3 , Ekaterina Yu. Gavrish 3 , Sofya ... al.[2]. Mannitol was isolated on a column (1.3 · 75 cm) with TSK HW-40(S) in 1% acetic acid using a Knauer differ- ential refractometer. Optical rotation was measured with a...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo Y học: Expression of recombinant murine pregnancy-associated plasma protein-A (PAPP-A) and a novel variant (PAPP-Ai) with differential proteolytic activity pot
... pregnancy-associated plasma protein -A (PAPP -A) cDNA encoding a 1545 amino-acid protein has been cloned. We have also identified and cloned cDNA that encodes a novel variant of PAPP -A, PAPP-Ai, carrying ... show that both PAPP -A and PAPP-Ai are active proteinases of about 400 kDa. Further analyses demonstrate that (1) both PAPP -A and PAPP-Ai cleave IGFBP-4 in an IGF dependent man...
Ngày tải lên: 31/03/2014, 21:21
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... AAGGAGGCACTGGGAGAGGGGAAAT -3’ (bases -1323 to -1299 from the major transcriptional initiation site) and antisense, 5’-AATTAGCTGGGCATGGTGGCAGGCG-3’ (bases -1075 to -1051)) that recognize part ... 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’- CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig. 1A)...
Ngày tải lên: 26/10/2012, 10:04
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Zhao Z, Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM. A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral ... incubation with a reporter antibody (HRP–conjugated anti–rabbit IgG, Santa Cruz Biotech, CA). The assay was developed using a stabilized HRP substrate. All samples were analyzed...
Ngày tải lên: 03/11/2012, 10:52
Domestic Wastewater Reclamation Coupled with Biofuel/Biomass Production Based on Microalgae: A Novel Wastewater Treatment Process in the Future
... reclamation coupled with biofuel/biomass production based on microalgae is proposed in this paper. The organic pollutants in wastewater are separated and concentrated by flocculation and filtration, ... centrifugation, and filtration, could be applied. By separating microalgal cells from the wastewater, clean water with low content of organics and inorganic nutrients could be obtained...
Ngày tải lên: 05/09/2013, 10:17
Research on a novel buck boost converter for wind turbine systems
... hotmail.com) Liuchen Chang is with University of New Brunswick, NB, Canada (e-mail: lchang@ unb.ca). Yaosuo Xue is with University of New Brunswick, NB, Canada (e-mail: y.x@ unb.ca). available ... (4) In practical implementation of an inverter control, a sinusoidal reference wave, serving as the modulating signal, is compared with a triangular wave, serving as the carrier s...
Ngày tải lên: 03/01/2014, 19:16