taking shape - a new contract between architecture and nature

... ‘place’ of architecture – and what has a place within architecture – traditionally. As beauty became more and more disassociated from a divine order, it was viewed as less and less necessary a ... emphasizes the still emergent state of an architecture that is engaging in a new contract of co-operation between built and natural environments, so- called ‘sustainable’...

Ngày tải lên: 29/04/2014, 15:44

... you use a card filing system. For each story you have one card for the title and author, and a card for every para- graph. On each of these paragraph cards you enter a main and a secondary key ... taking It is advisable, when taking notes, to have two blank pages ongoing at the same time. The left-hand page should be for mapped information and the right-hand page for more...

Ngày tải lên: 09/08/2013, 11:51

... of contrastive analysis in learning a foreign language which has particular effect on analyzing a language and its equivalents in other languages and then the author would like to make an over ... C .A plays an important role in learning a foreign language as a main subject at most language universals. According to C. James (1980;19), C .A is a form of inter-language study...

Ngày tải lên: 10/04/2013, 14:46

... Không gian đ a lí c a phương ngữ Nam Bộ được xác đònh hẹp hơn. Ranh giới PNNB trùng với ranh giới -3 6- đ a lí tự nhiên Nam Bộ mà chúng ta đang quan niệm hiện nay. Đây cũng là quan điểm trong việc ... Cao Xuân Hạo [29; 120] v.v. gọi là phương ngữ Nam Bộ. Như vậy, không gian đ a lí c a tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam được các tác giả xác đònh khá rộng. Khô...

Ngày tải lên: 17/04/2013, 16:09

... tsA58T Ag cDNA carry- ing the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotak...

Ngày tải lên: 18/02/2014, 17:20

... marital rape and sexual abuse, and against violence towards women and girls as a human rights violation; and for pro- g rammes “to encourage and enable men to adopt safe and responsible sexual ... , hotlines and radio call-in programmes; the Internet and CD-ROMs; and entertainment-edu- cation programmes are providing adolescent males the confidential, timely and anonymou...

Ngày tải lên: 05/03/2014, 16:20

... wd h9" alt=""

Ngày tải lên: 06/03/2014, 23:20

... between recombination and chromatin assembly during meiosis Satomi Ishii* , †, Akiyo Koshiyama*, Fumika N. Hamada, Takayuki Y. Nara, Kazuki Iwabata, Kengo Sakaguchi and Satoshi H. Namekawa Department of Applied ... 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG. To over- express N-terminal hexahistidine-tagged CcCac1L-N (His-CcCac1L-N) and CcCac1L-C (His-CcCa...

Ngày tải lên: 07/03/2014, 05:20

... Computa- tional Linguistics, pages 19–33. Mitesh Khapra, Sapan Shah, Piyush Kedia, and Push- pak Bhattacharyya. 2010. Domain-specific word sense disambiguation combining corpus based and wordnet based parameters. ... just 30% of the target data to the source data achieved the same perfor- mance as that obtained by taking the entire source and target data. Agirre and de Lacalle (2009)...

Ngày tải lên: 17/03/2014, 00:20

... strength and formation (Swanson 1950). Guar gum is a branched galactomannan polymer which has a linear 1-4 ȕ-D-mannan backbone with 1-6 -linked Į-D-galactose side groups on approximately every ... modification (Zhou et al. 2007). 16 Chitosan is a natural linear aminopolysaccharide of 1-4 ȕ-D-glucosamine derived from chitin by deacetylation. Chitin (linear 1-4 ȕ-N-acetyl-...

Ngày tải lên: 18/03/2014, 02:20