Báo cáo khoa học: Inhibition of human MDA-MB-231 breast cancer cell invasion by matrix metalloproteinase 3 involves degradation of plasminogen docx
... Inhibition of human MDA-MB- 231 breast cancer cell invasion by matrix metalloproteinase 3 involves degradation of plasminogen Antonietta R. Farina 1 , Antonella ... considered significant at P £ 0.05. RESULTS Inhibition of MDA-MB- 231 invasion by MMP -3 Human MDA-MB- 231 breast cancer cells constitutively express, MMP-9, low level MMP -3, TIMP...
Ngày tải lên: 31/03/2014, 09:20
... 5000 GST-hEAG(674–867) GST-C34 127 ± 15 12 83 ± 176 GST-hEAG(674–867)_F714SFÆ717S GST-C34_ FSÆFS 735 ± 114 > 5000 GST-hEAG(649–867) GST-C2B34 116 ± 44 134 3 ± 2 13 GST-hEAG(649–867)_F714SÆF717S GST-C2B34_FSÆFS ... in steps of 3) and C-terminal (amino-acids 480–962 in steps of 3 and amino-acids 645–895 in steps of 2) cytosolic domains of hEAG1. Binding of BODIPY FL-labeled hC...
Ngày tải lên: 07/03/2014, 12:20
... Biochemistry 44, 33 47 33 57. 34 Dahlqvist A (1964) Method for assay of intestinal disac- charidases. Anal Biochem 7, 18–25. E. J. Rossi et al. Inhibition of human maltase glucoamylase FEBS Journal 2 73 (2006) ... (µ M) [ 13] (µ M) 6 4 2 0 -3 -2 -1 0 1 2 3 1/A450 1/A450 -3 -2 -1 0 1 2 3 [14] (µ M) [15] (µ M) 12 10 10 8 6 4 2 0 8 6 4 2 0 -3 -2 -1 0 1 2 3 1/A450 1/A450 Fi...
Ngày tải lên: 07/03/2014, 12:20
Tài liệu Báo cáo khoa học: Inhibition of cobalamin-dependent methionine synthase by substituted benzo-fused heterocycles pptx
... (dimethylsulfoxide-d 6 ) d: 8 .35 (s, 1H, 2-H), 8.18 (d, J ¼ 2 Hz, 1H, 4-H), 7.06 (d, J ¼ 2 Hz, 1H, 6-H), 4. 03 (s, 3H, OCH 3 ), 3. 29 (s, 3H, NCH 3 ). HRMS (ES) (M + H) 208.0717, C 9 H 10 N 3 O 3 requires 208.0717. 5-Amino-7-methoxybenzimidazole ... 772–778. 34 Jenkins OH (1 936 ) The dipole moments of certain poly- nitro-compounds. J Chem Soc 00, 862–867. 33 35 Izzo P (1959)...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Inhibition of pneumococcal choline-binding proteins and cell growth by esters of bicyclic amines pptx
... lysis) of the cell wall is an essential process for both cell viability and liberation of viru- lence factors. Inhibition of autolysis by excess cho- line might, in the first instance, seem to be of therapeutic ... and cellular biology of pneumococcal infection. Curr Opin Microbiol 2, 35 39 . 12 Berry AM & Paton JC (2000) Additive attenuation of virulence of Streptoc...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Inhibition of pea ferredoxin–NADP(H) reductase by Zn-ferrocyanide docx
... l M Zn-ferrocyanide) Type of inhibition NADPH a 19.7 ± 2 .3 302 .3 ± 7.8 1.16 ± 0.1 31 .6 ± 2 .3 33. 0 ± 2 .3 Noncompetitive Ferricyanide b 106.0 ± 15.9 32 1.0 ± 11.86 1.57 ± 0.1 ND ND Noncompetitive DCPIP c 43. 3 ± 4.9 ... molar abso rtivity of the complex [37 ]. T his procedure does n ot require the determination of the titration endpoint [38 ]. Protection against inhibitio...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack docx
... appeared on the inhibition of GR by radiation-generated peroxides [34 ]. LDH has been shown to be inhibited by a number of oxidants, with this requiring the p resence of metal ions [ 53] , but is less ... inactivation of G APDH being metal- ion independent, whereas inhibition of GR and LDH by H 2 O 2 occurs most rapidly in the presence of metal ions. It is proposed that...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf
... 0 .34 0.84 ± 0.17 6.87 ± 0.79 4.92 ± 0.74 3. 76 ± 0.49 1 .39 ± 0.25 SGC7901/pcDNA3.1B 0. 43 ± 0. 03 0 .37 ± 0.05 0.28 ± 0.02 0.20 ± 0. 03 0. 43 ± 0. 03 0 .38 ± 0.06 0 .30 ± 0. 03 0.24 ± 0.04 SGC7901 0 .31 ... 0. 03 0.29 ± 0.04 0.25 ± 0. 03 0.19 ± 0.02 0 .31 ± 0. 03 0 .32 ± 0.05 0.26 ± 0.02 0.22 ± 0.04 Vincristine SGC7901/PrP C 7 .38 ± 0.78 5.21 ± 0.56 2.69 ± 0 .38 0 .34 ± 0.21 7 .38...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Inhibition of an iron-responsive element/iron regulatory protein-1 complex by ATP binding and hydrolysis docx
... 279, 433 45– 433 51. 39 Popovic Z & Templeton DM (2004) Iron accumulation and iron-regulatory protein activity in human hepatoma (HepG2) cells. Mol Cell Biochem 265, 37 –45. 40 Ku ¨ hn LC (20 03) ... homeostasis. EMBO J 23, 38 6 39 5. 34 Mo ¨ rikofer-Zwez S & Walter P (1989) Binding of ADP to rat liver cytosolic proteins and its influence on the ratio of free ATP ⁄ free AD...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt
... pGL3b:Prm3a, pGL3b:Prm3ab and pGL3b:Prm3aa A. T. Coyle et al. Effect of 15d-PGJ2 action on TP gene expression FEBS Journal 272 (2005) 4754–47 73 ª 2005 FEBS 4767 containing subdeletions of Prm3 ... Prm3abb; pGL3b:Prm3abb. (Primer Kin212, 5¢-dGAG A GGTACCGAGCAAGACTCTGTCTC AAA -3 , nucleo- tides )229 to )209). 3. Prm3abc; pGL3b:Prm3abc. (Primer Kin 236 , 5¢-dGAG AGGTACCCCGGAGAGGATATTTGAGC...
Ngày tải lên: 07/03/2014, 21:20