Báo cáo khoa học: A truncated form of DNA topoisomerase IIb associates with the mtDNA genome in mammalian mitochondria doc

... surprising if the mitochondrial form of DNA topoisomerase IIb does not assume an important role in mtDNA replication. By analogy to that of other eucaryotic Ó FEBS 2003 DNA Topo IIb mammalian mtDNA ... electrophoresis. The mitochondrial DNA topoisomerases II activity appears to be associated with mtDNA An association of DNA topoisomerase II with mtDN...

Ngày tải lên: 31/03/2014, 07:20

... that this is a cDNA for the Tm-mas. The Tm-mas has two domains, an N-terminal domain and a serine proteinase-like domain. The hydrophobic first 22 amino acids of the N-terminal end of the protein ... describes the purification and cDNA cloning of a 45-kDa protein that acts as a pro-PO activating cofactor in T. molitor larvae. The deduced amino acid sequence of t...

Ngày tải lên: 21/02/2014, 03:20

... GCG GGTACCAATGTGATGGGTGGACTGGT hRhoA +166 GCG AAGCTTACCAGACCGTGGACTAACGA hRhoB sense CCCACCGTCTTCGAGAACTA hRhoB antisense CTTCCTTGGTCTTGGCAGAG hRhoA sense CCAGACTAGATGTAGTATTTTTTG hRhoA antisense ATTAGAGCCAGATGCTTAAGTCC GAPDH-F ... interactions with an existing GEF, or finally by acting as GEFs themselves. Finally, in fibroblasts, the TGFb–Smad pathway causes transcriptional activation o...

Ngày tải lên: 16/03/2014, 06:20

... pEGhSUV3-380–786 and the following reverse primers: CCAT CCATGGCTAGGAAGCAAGGGACAGC TCTCC, GGAT CCATGGTCATGGAAACATATCCATA AATCGG and CCAT CCATGGTCAGTTGATAGGAGC TGTGAAGAAAAC, respectively (all incorporating ... blot in the indicated time points. (B) The protein stability of the fusion protein containing the C-ter- minal 136 amino acids of hSuv3p fused to TAP (hSuv3TAP-650–786) a...

Ngày tải lên: 23/03/2014, 15:21

... apolipoprotein C2; ApoC3-0, ApoC3 that does not contain a carbohydrate chain; ApoC3-1, ApoC3 with a GalNAc-Gal-sialic acid carbohydrate chain; ApoC3-2, ApoC3 containing the carbohydrate of ApoC3-1 plus an ... with approval by the institutional review board of the University of Minnesota, and informed consent was obtained for pro- tein analysis of the samples to discove...

Ngày tải lên: 19/02/2014, 05:20

... Thomas-Oates, J.E. & Brade, H. (1994) Preparation and structural analysis of oligosaccharide monophosphates obtained from the lipopolysaccharide of recombinant strains of Salmonella minnesota ... KOH. The lipo-oligosaccharide was also analyzed after acid treatment, attained by mild hydrolysis with acetic acid, to obtain information on the nature of the phosphate and acyl...

Ngày tải lên: 19/02/2014, 13:20

... concentration of AdoMet with J cystathionine decreasing and J Thr increasing as the concentration of AdoMet was increased. Half changes in J cystathionine and J Thr are obtained for a concentration in AdoMet ... threonine biosynthesis pathways in Arabidopsis thaliana (Fig. 1). The computer model was validated in vitro andusedtoexamine the branch-point kinetics in detai...

Ngày tải lên: 20/02/2014, 02:21

... [19]. In mammalian apop- tosis, caspase-8 and caspase-9 are known to be associ- ated with the mitochondrial pathway. Active caspase-8 induces the release of mitochondrial apoptosis factors, in a ... seen in the apoptotic nucleus [29,30]. The large- fragment-size DNA fragmentation and DNA laddering are characteristics of the apoptotic nucleus, and the final DNA...

Ngày tải lên: 20/02/2014, 03:20

... src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAABKYAAAYwCAIAAADH3NDGAAAACXBIWXMAABYlAAAWJQFJUiTwAAAgAElEQVR42uzdf2zV9b348c85LeXQlhbhSCc17YFVqAJBma3bWsicyiVwvXpFut3e 9A/ ZLvOi3Ft3k1VJ0+QyIvQumd1gxmsydnOr 9a4 4wItwGZfNrdS7rOXC7YQruav2xyRbba1QaltKe873jyZk2Xd3t8fLpYKPx1+mhJfH97sJPvm8+/6EEolEAAAAwPUobAkAAAAkHwAAAJIPAAAAyQcAAIDkAwAAQPIBAAAg+QAAACQfAAAAkg8AAADJBwAAgOQDAABA8gEAACD5AAAAJB8AAACSDwAA...

Ngày tải lên: 20/02/2014, 04:20

... tetrasaccharide-ribitol. The data shows that the AAT residue is indeed an acetamido-amino derivative and supports the postulated repeat as CBADE. From the combined data obtained from NMR and mass spectrometry the ... residue, the latter corresponding to the sodium adduct. Thus the ESI-MS clearly showed that the majority of the material constituted of a tetrasaccha- r...

Ngày tải lên: 20/02/2014, 11:20