Báo cáo khoa học: "Japanese Idiom Recognition: Drawing a Line between Literal and Idiomatic Meanings" docx

Báo cáo khoa học: "Japanese Idiom Recognition: Drawing a Line between Literal and Idiomatic Meanings" docx

Báo cáo khoa học: "Japanese Idiom Recognition: Drawing a Line between Literal and Idiomatic Meanings" docx

... & Dependency Analysis Dependency Matching yaku part /ni DAT /wa TOP mattaku totally tatu stand / nai NEG Output yaku part / ni DAT /wa TOP mattaku totally tatu stand / nai NEG Idiom Recognizer Idiom Dictionary ··· yaku part /ni DAT tatu stand ··· Dependency ... understanding. This paper discusses the lexical knowledge of idioms for idiom recognition. The chal- lenges are that idioms...

Ngày tải lên: 31/03/2014, 01:20

8 294 0
Tài liệu Báo cáo khoa học: The RNA recognition motif, a plastic RNA-binding platform to regulate post-transcriptional gene expression ppt

Tài liệu Báo cáo khoa học: The RNA recognition motif, a plastic RNA-binding platform to regulate post-transcriptional gene expression ppt

... ribonucleoprotein A. Nature 348, 515–520. 18 Liker E, Fernandez E, Izaurralde E & Conti E (2000) The structure of the mRNA export factor TAP reveals a cis arrangement of a non-canonical RNP domain and an ... Biochemical characterizations of the mRNA polyadenylate binding protein (PABP) and the hnRNP protein C shed light on a consensus RNA-binding domain of approximately 90 amin...

Ngày tải lên: 19/02/2014, 17:20

14 428 0
Tài liệu Báo cáo khoa học: "Japanese OCR Error Correction using Character Shape Similarity and Statistical Language Model " pptx

Tài liệu Báo cáo khoa học: "Japanese OCR Error Correction using Character Shape Similarity and Statistical Language Model " pptx

... Japanese OCR Error Correction using Character Shape Similarity and Statistical Language Model Masaaki NAGATA NTT Information and Communication Systems Laboratories 1-1 Hikari-no-oka Yokosuka-Shi ... such as Japanese and Chinese. It consists of a statistical OCR model, an approxi- mate word matching method using character shape similarity, and a word segmentation algorithm u...

Ngày tải lên: 20/02/2014, 18:20

7 472 0
Tài liệu Báo cáo khoa học: Time-dependent regulation analysis dissects shifts between metabolic and gene-expression regulation during nitrogen starvation in baker’s yeast doc

Tài liệu Báo cáo khoa học: Time-dependent regulation analysis dissects shifts between metabolic and gene-expression regulation during nitrogen starvation in baker’s yeast doc

... the capacities of hexokinase (HXK), aldolase (ALD), PGK, GPM, PYK and pyruvate decarboxylase (PDC) were upregulated. The capacity of alcohol dehy- drogenase (ADH) was downregulated and the capaci- ties ... Netherlands) and 3 lL of cDNA template (equivalent to 1 ng of RNA). Amplification, data acquisition, and data analysis were car- ried out in the ABI 7900 Prism Sequence Detector (onc...

Ngày tải lên: 18/02/2014, 06:20

16 654 0
Báo cáo khoa học: Reaction of human UMP-CMP kinase with natural and analog substrates docx

Báo cáo khoa học: Reaction of human UMP-CMP kinase with natural and analog substrates docx

... UMP-CMP kinase; antiviral analog; 3TC; AraC; phosphorylation. Nucleoside analogs constitute a familly of important antiviral and anticancer drugs. Analogs of thymidine like AZT (2¢3¢-deoxy-3¢azido ... Reaction of human UMP-CMP kinase with natural and analog substrates Claudia Pasti 1, * , †, Sarah Gallois-Montbrun 1, †, He ´ le ` ne Munier-Lehmann 2 , Michel Veron 1 , Anne-Marie Gilles...

Ngày tải lên: 08/03/2014, 02:20

7 384 0
Báo cáo khoa học: "Word classification based on combined measures of distributional and semantic similarity" docx

Báo cáo khoa học: "Word classification based on combined measures of distributional and semantic similarity" docx

... to assign new words to those classes that are semantically related to other likely candidate classes and dis- favors those classes that appear to be semanti- cally distant from other candidates. To ... more challenging. For ex- ample, Alfonseca and Manandhar (2002) attain the learning accuracy' of 38% when assigning new words to 46 WordNet concepts. In the present paper we propose...

Ngày tải lên: 08/03/2014, 21:20

4 345 0
Báo cáo khoa học: "Finding Word Substitutions Using a Distributional Similarity Baseline and Immediate Context Overlap" potx

Báo cáo khoa học: "Finding Word Substitutions Using a Distributional Similarity Baseline and Immediate Context Overlap" potx

... distributional similarity baseline (a sub- set of Wikipedia) in an attempt to show that a good semantic parse and adequate filtering can provide reasonable performance even on domains where data is sparse. ... the head ‘rescue’, lemma:rescue arg:ARG2 var:bank which indicates that ‘bank’ is object of the head ‘rescue’, and lemma:failing arg:ARG1 var:bank which indicates that the argument...

Ngày tải lên: 08/03/2014, 21:20

9 248 0
Báo cáo khoa học: In vitro analysis of the relationship between endonuclease and maturase activities in the bi-functional doc

Báo cáo khoa học: In vitro analysis of the relationship between endonuclease and maturase activities in the bi-functional doc

... AnI19R 5¢-AATTCATGAGGAGGTTTCTCTGTAACA-3¢;AnI19H 5¢-AGCTTGTTACAG-AGAAACCTCCTCATG-3¢; AnI17R 5¢-AATTCACGAGGAGGTTTCTCTGTACTA-3¢; AnI17H 5¢-AGCTTAGTACAGAGAAACCTCCTCG TG-3¢;AnI15R5¢-AATTCACAGGAGGTTTCTCT-GTC TA-3¢;AnI15H5¢-AGCTTAGACAGAGAAACCTCC TGTG-3¢. ... (Integrated DNA Technologies, Coralville, IA, USA) were annealed together to make recognition site variants containing 5¢-EcoRI and 3¢-HindII...

Ngày tải lên: 17/03/2014, 10:20

12 483 0
Báo cáo khoa học: Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis doc

Báo cáo khoa học: Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis doc

... 295 1A GCTCTAGAGTTTAAACGATCTCATTGTTGGGGCGC 2951B GCTCTAGAGTTTAAACATAGTCAATGAACTTGTACGC 2951C AGGAAGGCCGGCAAATGGC 2951D TTCACGTGAGATAAGCTCCC 2951E ACGGTTTCGGTGAAGCCAG 2951L ACAATTAATTAACAGTATGTACGAGCGATGCG 2951M ... ACAATTAATTAACAGTATGTACGAGCGATGCG 2951M ACAAAAGCTTGGCGCAAATCATAGCTTCTTG ppsE ppsE1 GACTAGTTTAAACGGATCGACGAGTTCGACGC ppsE2 GACTAGTTTAAACGAGGCACTGTGACCAGATGC ppsE3 CGTTCTGGAGCAACCTTC...

Ngày tải lên: 23/03/2014, 09:20

13 537 0
Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf

Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf

... pDU-PABP(s) EarI-catgaaccccagtgcc 7 pDU-RBDII(s) EarI-catggatgttataaagggc 8 pDU-RBDIII(s) EarI-catgggacgatttaagtct 9 pDU-RBDIV(s) EarI-catggaacagatgaaacaa 10 pDU-PABPC(s) EarI-catggagcgccaggctcac 11 pDU-IMP1(s) ... PABP, and surpris- ingly we have found that both polypeptides bind strongly to a 22 nucleotide long CCCAAAAAAA UUUACAAAAAA sequence located at the 3¢ end of the ARS. Furthermor...

Ngày tải lên: 23/03/2014, 10:20

13 466 0
w