Báo cáo khoa học: SLC39A14, a LZT protein, is induced in adipogenesis and transports zinc pptx

... during adipogenesis FEBS Journal 272 (2005) 1590–1599 ª 2005 FEBS 1599 SLC3 9A1 4, a LZT protein, is induced in adipogenesis and transports zinc Kei Tominaga 1,2 , Takeshi Kagata 1 , Yoshikazu ... Ltd), a SLC3 9A1 4-specific forward primer: 5¢-CCCACTCAGTAGCTGTGT-3¢,5¢-CAATGCTGGCAT GAGCAT-3¢ or 5¢-CTTCTTGGGGAAACATG-3¢, and a reverse primer: 5¢-CCAGCATAATGGAGAAGC-3¢...

Ngày tải lên: 30/03/2014, 16:20

... TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA CARP Cardiac ankyrin repeat protein NM_013468 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: TGGCACTGATTTTGGCTCCT E2-14 ... TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: GTGCTTTGACACCCACGGTA Ub Ubiquitin X51703 22mUbiq.F: TCGGCGGTCTTTCTGTGAG 51mUbiq.P: TGTTTCGACGCGCTGGGCG 96mUbiq.R: GTTAACAAATGTG...

Ngày tải lên: 07/03/2014, 03:20

... Sharma 1 , Meetu Gupta 1 , Ananth Krupa 2, *, Narayanaswamy Srinivasan 2 and Yogendra Singh 1 1 Institute of Genomics and Integrative Biology, Delhi, India 2 Molecular Biophysics Unit, Indian Institute ... protein phosphatase, a phosphoprotein-binding domain. Proc Natl Acad Sci USA 96, 7821–7826. 32 Chopra P, Singh A, Koul A, Ramachandran S, Drlica K, Tyagi AK & Singh Y (2003) Cyt...

Ngày tải lên: 16/03/2014, 14:20

... recognition. In recent years, a number of studies have inves- tigated integrating emotions and music in certain media applications. For example, Ishizuka and Onisawa (2006) generated variations of ... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format....

Ngày tải lên: 20/02/2014, 05:20

... meeting browsing and retrieval Marita Ailomaa, Miroslav Melichar, Martin Rajman Artificial Intelligence Laboratory ´ Ecole Polytechnique F ´ ed ´ erale de Lausanne CH-1015 Lausanne, Switzerland marita.ailomaa@epfl.ch Agnes ... considered and controlled for in the experiment increases substantially. For instance, if it is the case that within a single inter- face any task that can be...

Ngày tải lên: 20/02/2014, 12:20

... USA) and flowjo software (TreeStar, Ashland, OR, USA). Mice and teratoma formation C57BL ⁄ 6J mice and MCH:ICR mice were purchased from CLEA Japan (Tokyo, Japan). All of the mice were main- tained ... 1283–1297. 24 Sakaki-Yumoto M, Kobayashi C, Sato A, Fujimura S, Matsumoto Y, Takasato M, Kodama T, Aburatani H, Asashima M, Yoshida N et al. (2006) The murine homolog of SALL4, a causat...

Ngày tải lên: 07/03/2014, 00:20

... designed as a substrate for CDR1, an atypical AP from Arabidopsis thaliana [13], was readily hydrolyzed by shewasin A at pH 4. Analy- sis by MS revealed that the primary cleavage site was at Leu*Phe ... to an N-terminal His-tag. (A) HisTrapHP chromatogram. Recombinant shewasin A was purified by metal ion affinity chromatography with a HisT- rapHP column. Elution was accomplished by usin...

Ngày tải lên: 14/03/2014, 22:20

... to amplify the cDNA containing the procarboxypeptidase by PCR. Sense primer 5¢-GATTCT CTCGAGAAAAGAAAACATGAAATTT ATGATGG-3¢; antisense primer 5¢-CTTCTTTGAGT TATGACGAATT GGATCCTAC-3¢. The original ... was measured against the substrate AAFP. The activity of CPAHa in the absence of inhibitor is defined as v o and the parameter a is defined as v i /v o . By plotting [I]/1 ) a against 1...

Ngày tải lên: 17/03/2014, 03:20

... human translators and second language learners. 2 Aligning the corpus Central to TotalRecall is a bilingual corpus and a set of programs that provide the bilingual analyses to yield a translation ... to continuously updating the database with newer information from Sinorama magazine so that the concordance is kept current and relevant to the . To make these up to dat...

Ngày tải lên: 17/03/2014, 06:20

... similar to those described previously [49,51]. Briefly, to prepare RNA ⁄ DNA hetero- duplexes, a 44 nucleotide long R01 RNA (5¢-GGGCG AAUUCAAAACAAAACAAAAC UAGCACCGUAAAGC Leishmania LeIF is an eIF 4A- like ... & Larraga V (2003) Protection in dogs against visceral leishmaniasis caused by Leishmania infantum is achieved by immunization with a heterologous prime-boost regime using D...

Ngày tải lên: 23/03/2014, 10:20